\
| Variant ID: vg0718117891 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 18117891 |
| Reference Allele: CCCAAA | Alternative Allele: TCCAAA,C,CA |
| Primary Allele: TCCAAA | Secondary Allele: CCCAAA |
Inferred Ancestral Allele : CA (evidence from allele frequency in Oryza rufipogon: CA: 0.75, CAA: 0.18, CCCAAA: 0.06, C: 0.01, others allele: 0.00, population size: 80. )
CCTTTGCTTATCAAACGGAAAGTGGGCCATTTCCAAAATAATCTACTACAGTAATTAATCTAGTACTCCGTACTACGTGCCCACCAACTACTCTCTCTGT[CCCAAA/TCCAAA,C,CA]
AAAAAAACTCAATTTCTGAGTTTACATGTTTAACATTTGACCGTCTGTTTTATTTAAAAAAAATTAAAAAAATTAAAAAGATAAGTCATGCATAAAGTAT
ATACTTTATGCATGACTTATCTTTTTAATTTTTTTAATTTTTTTTAAATAAAACAGACGGTCAAATGTTAAACATGTAAACTCAGAAATTGAGTTTTTTT[TTTGGG/TTTGGA,G,TG]
ACAGAGAGAGTAGTTGGTGGGCACGTAGTACGGAGTACTAGATTAATTACTGTAGTAGATTATTTTGGAAATGGCCCACTTTCCGTTTGATAAGCAAAGG
| Populations | Population Size | Frequency of TCCAAA(primary allele) | Frequency of CCCAAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.90% | 28.90% | 18.81% | 10.79% | C: 4.55%; CA: 0.13% |
| All Indica | 2759 | 52.20% | 26.40% | 12.14% | 9.24% | C: 0.04% |
| All Japonica | 1512 | 12.40% | 35.70% | 25.07% | 12.50% | C: 13.89%; CA: 0.40% |
| Aus | 269 | 32.00% | 18.20% | 39.41% | 10.41% | NA |
| Indica I | 595 | 71.60% | 16.60% | 8.74% | 2.86% | C: 0.17% |
| Indica II | 465 | 21.50% | 63.70% | 8.82% | 6.02% | NA |
| Indica III | 913 | 61.70% | 13.30% | 11.72% | 13.36% | NA |
| Indica Intermediate | 786 | 44.70% | 27.00% | 17.18% | 11.20% | NA |
| Temperate Japonica | 767 | 0.40% | 48.00% | 19.69% | 7.17% | C: 23.99%; CA: 0.78% |
| Tropical Japonica | 504 | 30.60% | 19.00% | 30.36% | 16.27% | C: 3.77% |
| Japonica Intermediate | 241 | 12.90% | 31.50% | 31.12% | 21.58% | C: 2.90% |
| VI/Aromatic | 96 | 6.20% | 16.70% | 51.04% | 22.92% | C: 3.12% |
| Intermediate | 90 | 24.40% | 34.40% | 22.22% | 17.78% | C: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718117891 | CCCAAA -> CA | LOC_Os07g30610.1 | upstream_gene_variant ; 2641.0bp to feature; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117891 | CCCAAA -> CA | LOC_Os07g30610-LOC_Os07g30620 | intergenic_region ; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117891 | CCCAAA -> DEL | N | N | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117891 | CCCAAA -> TCCAAA | LOC_Os07g30610.1 | upstream_gene_variant ; 2640.0bp to feature; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117891 | CCCAAA -> TCCAAA | LOC_Os07g30610-LOC_Os07g30620 | intergenic_region ; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117891 | CCCAAA -> C | LOC_Os07g30610.1 | upstream_gene_variant ; 2641.0bp to feature; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117891 | CCCAAA -> C | LOC_Os07g30610-LOC_Os07g30620 | intergenic_region ; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718117891 | 4.59E-06 | NA | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | 1.17E-06 | 2.14E-07 | mr1480 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | 2.09E-08 | NA | mr1692 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | 1.59E-07 | 1.41E-08 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | NA | 8.84E-08 | mr1968 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | NA | 8.85E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | 2.58E-06 | NA | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | 1.68E-07 | 1.95E-08 | mr1480_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | NA | 4.92E-07 | mr1711_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117891 | NA | 4.26E-09 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |