\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718117891:

Variant ID: vg0718117891 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 18117891
Reference Allele: CCCAAAAlternative Allele: TCCAAA,C,CA
Primary Allele: TCCAAASecondary Allele: CCCAAA

Inferred Ancestral Allele : CA (evidence from allele frequency in Oryza rufipogon: CA: 0.75, CAA: 0.18, CCCAAA: 0.06, C: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTTGCTTATCAAACGGAAAGTGGGCCATTTCCAAAATAATCTACTACAGTAATTAATCTAGTACTCCGTACTACGTGCCCACCAACTACTCTCTCTGT[CCCAAA/TCCAAA,C,CA]
AAAAAAACTCAATTTCTGAGTTTACATGTTTAACATTTGACCGTCTGTTTTATTTAAAAAAAATTAAAAAAATTAAAAAGATAAGTCATGCATAAAGTAT

Reverse complement sequence

ATACTTTATGCATGACTTATCTTTTTAATTTTTTTAATTTTTTTTAAATAAAACAGACGGTCAAATGTTAAACATGTAAACTCAGAAATTGAGTTTTTTT[TTTGGG/TTTGGA,G,TG]
ACAGAGAGAGTAGTTGGTGGGCACGTAGTACGGAGTACTAGATTAATTACTGTAGTAGATTATTTTGGAAATGGCCCACTTTCCGTTTGATAAGCAAAGG

Allele Frequencies:

Populations Population SizeFrequency of TCCAAA(primary allele) Frequency of CCCAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 28.90% 18.81% 10.79% C: 4.55%; CA: 0.13%
All Indica  2759 52.20% 26.40% 12.14% 9.24% C: 0.04%
All Japonica  1512 12.40% 35.70% 25.07% 12.50% C: 13.89%; CA: 0.40%
Aus  269 32.00% 18.20% 39.41% 10.41% NA
Indica I  595 71.60% 16.60% 8.74% 2.86% C: 0.17%
Indica II  465 21.50% 63.70% 8.82% 6.02% NA
Indica III  913 61.70% 13.30% 11.72% 13.36% NA
Indica Intermediate  786 44.70% 27.00% 17.18% 11.20% NA
Temperate Japonica  767 0.40% 48.00% 19.69% 7.17% C: 23.99%; CA: 0.78%
Tropical Japonica  504 30.60% 19.00% 30.36% 16.27% C: 3.77%
Japonica Intermediate  241 12.90% 31.50% 31.12% 21.58% C: 2.90%
VI/Aromatic  96 6.20% 16.70% 51.04% 22.92% C: 3.12%
Intermediate  90 24.40% 34.40% 22.22% 17.78% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718117891 CCCAAA -> CA LOC_Os07g30610.1 upstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0718117891 CCCAAA -> CA LOC_Os07g30610-LOC_Os07g30620 intergenic_region ; MODIFIER silent_mutation Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0718117891 CCCAAA -> DEL N N silent_mutation Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0718117891 CCCAAA -> TCCAAA LOC_Os07g30610.1 upstream_gene_variant ; 2640.0bp to feature; MODIFIER silent_mutation Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0718117891 CCCAAA -> TCCAAA LOC_Os07g30610-LOC_Os07g30620 intergenic_region ; MODIFIER silent_mutation Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0718117891 CCCAAA -> C LOC_Os07g30610.1 upstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 N N N N
vg0718117891 CCCAAA -> C LOC_Os07g30610-LOC_Os07g30620 intergenic_region ; MODIFIER silent_mutation Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718117891 4.59E-06 NA mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 1.17E-06 2.14E-07 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 2.09E-08 NA mr1692 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 1.59E-07 1.41E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 NA 8.84E-08 mr1968 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 NA 8.85E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 2.58E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 1.68E-07 1.95E-08 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 NA 4.92E-07 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117891 NA 4.26E-09 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251