Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718117888:

Variant ID: vg0718117888 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 18117888
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTACCTTTGCTTATCAAACGGAAAGTGGGCCATTTCCAAAATAATCTACTACAGTAATTAATCTAGTACTCCGTACTACGTGCCCACCAACTACTCTCTC[T/C]
GTCCCAAAAAAAAAACTCAATTTCTGAGTTTACATGTTTAACATTTGACCGTCTGTTTTATTTAAAAAAAATTAAAAAAATTAAAAAGATAAGTCATGCA

Reverse complement sequence

TGCATGACTTATCTTTTTAATTTTTTTAATTTTTTTTAAATAAAACAGACGGTCAAATGTTAAACATGTAAACTCAGAAATTGAGTTTTTTTTTTGGGAC[A/G]
GAGAGAGTAGTTGGTGGGCACGTAGTACGGAGTACTAGATTAATTACTGTAGTAGATTATTTTGGAAATGGCCCACTTTCCGTTTGATAAGCAAAGGTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.70%	38.00%	8.97%	9.29%	NA
All Indica	2759	70.40%	19.30%	6.60%	3.70%	NA
All Japonica	1512	0.50%	65.50%	13.43%	20.57%	NA
Aus	269	31.60%	67.30%	0.37%	0.74%	NA
Indica I	595	75.00%	18.20%	5.04%	1.85%	NA
Indica II	465	84.10%	11.20%	3.23%	1.51%	NA
Indica III	913	67.80%	19.90%	6.79%	5.48%	NA
Indica Intermediate	786	61.80%	24.30%	9.54%	4.33%	NA
Temperate Japonica	767	0.70%	57.10%	10.82%	31.42%	NA
Tropical Japonica	504	0.00%	77.40%	13.89%	8.73%	NA
Japonica Intermediate	241	1.20%	67.20%	20.75%	10.79%	NA
VI/Aromatic	96	1.00%	57.30%	23.96%	17.71%	NA
Intermediate	90	32.20%	43.30%	16.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0718117888	T -> DEL	N	N	silent_mutation	Average:53.085; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N
vg0718117888	T -> C	LOC_Os07g30610.1	upstream_gene_variant ; 2637.0bp to feature; MODIFIER	silent_mutation	Average:53.085; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N
vg0718117888	T -> C	LOC_Os07g30610-LOC_Os07g30620	intergenic_region ; MODIFIER	silent_mutation	Average:53.085; most accessible tissue: Minghui63 root, score: 73.73	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0718117888	NA	4.94E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	4.82E-06	4.23E-07	mr1480	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	2.34E-07	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	1.76E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	1.34E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	2.78E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	5.83E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	1.53E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	1.68E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	5.42E-08	NA	mr1480_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	3.51E-09	4.57E-11	mr1480_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	1.51E-12	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	2.70E-17	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	9.09E-06	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718117888	NA	7.99E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251