\
| Variant ID: vg0718117888 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18117888 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTACCTTTGCTTATCAAACGGAAAGTGGGCCATTTCCAAAATAATCTACTACAGTAATTAATCTAGTACTCCGTACTACGTGCCCACCAACTACTCTCTC[T/C]
GTCCCAAAAAAAAAACTCAATTTCTGAGTTTACATGTTTAACATTTGACCGTCTGTTTTATTTAAAAAAAATTAAAAAAATTAAAAAGATAAGTCATGCA
TGCATGACTTATCTTTTTAATTTTTTTAATTTTTTTTAAATAAAACAGACGGTCAAATGTTAAACATGTAAACTCAGAAATTGAGTTTTTTTTTTGGGAC[A/G]
GAGAGAGTAGTTGGTGGGCACGTAGTACGGAGTACTAGATTAATTACTGTAGTAGATTATTTTGGAAATGGCCCACTTTCCGTTTGATAAGCAAAGGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 38.00% | 8.97% | 9.29% | NA |
| All Indica | 2759 | 70.40% | 19.30% | 6.60% | 3.70% | NA |
| All Japonica | 1512 | 0.50% | 65.50% | 13.43% | 20.57% | NA |
| Aus | 269 | 31.60% | 67.30% | 0.37% | 0.74% | NA |
| Indica I | 595 | 75.00% | 18.20% | 5.04% | 1.85% | NA |
| Indica II | 465 | 84.10% | 11.20% | 3.23% | 1.51% | NA |
| Indica III | 913 | 67.80% | 19.90% | 6.79% | 5.48% | NA |
| Indica Intermediate | 786 | 61.80% | 24.30% | 9.54% | 4.33% | NA |
| Temperate Japonica | 767 | 0.70% | 57.10% | 10.82% | 31.42% | NA |
| Tropical Japonica | 504 | 0.00% | 77.40% | 13.89% | 8.73% | NA |
| Japonica Intermediate | 241 | 1.20% | 67.20% | 20.75% | 10.79% | NA |
| VI/Aromatic | 96 | 1.00% | 57.30% | 23.96% | 17.71% | NA |
| Intermediate | 90 | 32.20% | 43.30% | 16.67% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718117888 | T -> DEL | N | N | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117888 | T -> C | LOC_Os07g30610.1 | upstream_gene_variant ; 2637.0bp to feature; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| vg0718117888 | T -> C | LOC_Os07g30610-LOC_Os07g30620 | intergenic_region ; MODIFIER | silent_mutation | Average:53.085; most accessible tissue: Minghui63 root, score: 73.73 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718117888 | NA | 4.94E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | 4.82E-06 | 4.23E-07 | mr1480 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 2.34E-07 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 1.76E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 1.34E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 2.78E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 5.83E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 1.53E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 1.68E-18 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | 5.42E-08 | NA | mr1480_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | 3.51E-09 | 4.57E-11 | mr1480_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 1.51E-12 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 2.70E-17 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 9.09E-06 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718117888 | NA | 7.99E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |