\
| Variant ID: vg0718107373 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18107373 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.54, C: 0.46, others allele: 0.00, population size: 100. )
GTCCAACCGTTTGCATGACGCGTACAACGCGCGGTCGCACGTCTCTATGAAAGTACTTTGGAGAACAGGGTTTGTCTCCTTTTATAGCGTATTCTAACTT[T/C]
TGACTTGGGATTTAGCCTCTCAAAAAAGGGCATCTTTCCCCGAAAAAAAAGGGGCATCTTGATAAAGAACCCCTTATGGTAGCCTAGCTAATTACTTATA
TATAAGTAATTAGCTAGGCTACCATAAGGGGTTCTTTATCAAGATGCCCCTTTTTTTTCGGGGAAAGATGCCCTTTTTTGAGAGGCTAAATCCCAAGTCA[A/G]
AAGTTAGAATACGCTATAAAAGGAGACAAACCCTGTTCTCCAAAGTACTTTCATAGAGACGTGCGACCGCGCGTTGTACGCGTCATGCAAACGGTTGGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.20% | 37.30% | 0.15% | 0.32% | NA |
| All Indica | 2759 | 46.30% | 53.00% | 0.18% | 0.51% | NA |
| All Japonica | 1512 | 87.20% | 12.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 68.80% | 30.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 23.70% | 75.50% | 0.34% | 0.50% | NA |
| Indica II | 465 | 76.30% | 22.60% | 0.22% | 0.86% | NA |
| Indica III | 913 | 39.90% | 59.80% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 53.20% | 46.10% | 0.13% | 0.64% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.80% | 31.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718107373 | T -> DEL | N | N | silent_mutation | Average:37.088; most accessible tissue: Callus, score: 59.031 | N | N | N | N |
| vg0718107373 | T -> C | LOC_Os07g30590.1 | upstream_gene_variant ; 3658.0bp to feature; MODIFIER | silent_mutation | Average:37.088; most accessible tissue: Callus, score: 59.031 | N | N | N | N |
| vg0718107373 | T -> C | LOC_Os07g30600.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.088; most accessible tissue: Callus, score: 59.031 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718107373 | NA | 1.92E-06 | mr1480 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107373 | 4.18E-07 | NA | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107373 | 1.16E-06 | 1.04E-07 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107373 | NA | 3.78E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107373 | 1.60E-06 | NA | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107373 | 1.26E-08 | 1.49E-09 | mr1480_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107373 | NA | 1.17E-06 | mr1711_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107373 | NA | 5.06E-10 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |