\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718107300:

Variant ID: vg0718107300 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18107300
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.23, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTTTTAAATAAAGTTTGTGAATAGAGATACATACGTCTAAAAGTCTAGCGCATATGGGATCTATGTGAGGTCCAACCGTTTGCATGACGCGTACAA[C/T]
GCGCGGTCGCACGTCTCTATGAAAGTACTTTGGAGAACAGGGTTTGTCTCCTTTTATAGCGTATTCTAACTTTTGACTTGGGATTTAGCCTCTCAAAAAA

Reverse complement sequence

TTTTTTGAGAGGCTAAATCCCAAGTCAAAAGTTAGAATACGCTATAAAAGGAGACAAACCCTGTTCTCCAAAGTACTTTCATAGAGACGTGCGACCGCGC[G/A]
TTGTACGCGTCATGCAAACGGTTGGACCTCACATAGATCCCATATGCGCTAGACTTTTAGACGTATGTATCTCTATTCACAAACTTTATTTAAAAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.20% 0.13% 0.36% NA
All Indica  2759 46.50% 52.80% 0.18% 0.54% NA
All Japonica  1512 87.20% 12.70% 0.07% 0.00% NA
Aus  269 68.80% 30.90% 0.00% 0.37% NA
Indica I  595 24.00% 75.10% 0.17% 0.67% NA
Indica II  465 76.30% 22.60% 0.43% 0.65% NA
Indica III  913 40.10% 59.60% 0.11% 0.22% NA
Indica Intermediate  786 53.30% 45.80% 0.13% 0.76% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 68.50% 31.30% 0.20% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718107300 C -> DEL N N silent_mutation Average:44.721; most accessible tissue: Callus, score: 79.831 N N N N
vg0718107300 C -> T LOC_Os07g30590.1 upstream_gene_variant ; 3585.0bp to feature; MODIFIER silent_mutation Average:44.721; most accessible tissue: Callus, score: 79.831 N N N N
vg0718107300 C -> T LOC_Os07g30600.1 intron_variant ; MODIFIER silent_mutation Average:44.721; most accessible tissue: Callus, score: 79.831 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718107300 NA 2.55E-06 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 5.72E-07 NA mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 1.55E-06 1.83E-07 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 NA 6.47E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 1.13E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 6.90E-09 1.87E-09 mr1480_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 NA 2.99E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 NA 2.23E-06 mr1711_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 5.52E-06 NA mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718107300 1.76E-06 3.76E-10 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251