\
| Variant ID: vg0718107300 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18107300 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.23, others allele: 0.00, population size: 86. )
ATTTTTTTTAAATAAAGTTTGTGAATAGAGATACATACGTCTAAAAGTCTAGCGCATATGGGATCTATGTGAGGTCCAACCGTTTGCATGACGCGTACAA[C/T]
GCGCGGTCGCACGTCTCTATGAAAGTACTTTGGAGAACAGGGTTTGTCTCCTTTTATAGCGTATTCTAACTTTTGACTTGGGATTTAGCCTCTCAAAAAA
TTTTTTGAGAGGCTAAATCCCAAGTCAAAAGTTAGAATACGCTATAAAAGGAGACAAACCCTGTTCTCCAAAGTACTTTCATAGAGACGTGCGACCGCGC[G/A]
TTGTACGCGTCATGCAAACGGTTGGACCTCACATAGATCCCATATGCGCTAGACTTTTAGACGTATGTATCTCTATTCACAAACTTTATTTAAAAAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 37.20% | 0.13% | 0.36% | NA |
| All Indica | 2759 | 46.50% | 52.80% | 0.18% | 0.54% | NA |
| All Japonica | 1512 | 87.20% | 12.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 68.80% | 30.90% | 0.00% | 0.37% | NA |
| Indica I | 595 | 24.00% | 75.10% | 0.17% | 0.67% | NA |
| Indica II | 465 | 76.30% | 22.60% | 0.43% | 0.65% | NA |
| Indica III | 913 | 40.10% | 59.60% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 53.30% | 45.80% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 68.50% | 31.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 77.80% | 22.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718107300 | C -> DEL | N | N | silent_mutation | Average:44.721; most accessible tissue: Callus, score: 79.831 | N | N | N | N |
| vg0718107300 | C -> T | LOC_Os07g30590.1 | upstream_gene_variant ; 3585.0bp to feature; MODIFIER | silent_mutation | Average:44.721; most accessible tissue: Callus, score: 79.831 | N | N | N | N |
| vg0718107300 | C -> T | LOC_Os07g30600.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.721; most accessible tissue: Callus, score: 79.831 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718107300 | NA | 2.55E-06 | mr1480 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | 5.72E-07 | NA | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | 1.55E-06 | 1.83E-07 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | NA | 6.47E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | 1.13E-06 | NA | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | 6.90E-09 | 1.87E-09 | mr1480_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | NA | 2.99E-08 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | NA | 2.23E-06 | mr1711_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | 5.52E-06 | NA | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718107300 | 1.76E-06 | 3.76E-10 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |