\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0718105499:

Variant ID: vg0718105499 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 18105499
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.47, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGTCTCGGATATGTCTAATGGTTGCTATAATTCCACCCGTCACAGGTAGGTGGCCACCTATATATGACGGGCCGCCATTTGCACCCCGACAGAGGTCG[A/G]
GTCTCGGACGATGACCTCACCTGTTATTACGACATTCTGTTGGACCTGCCACTGGTGAAGTCATCCATAACAAGCACTTTGGGCTATCACAGGTGGGCCG

Reverse complement sequence

CGGCCCACCTGTGATAGCCCAAAGTGCTTGTTATGGATGACTTCACCAGTGGCAGGTCCAACAGAATGTCGTAATAACAGGTGAGGTCATCGTCCGAGAC[T/C]
CGACCTCTGTCGGGGTGCAAATGGCGGCCCGTCATATATAGGTGGCCACCTACCTGTGACGGGTGGAATTATAGCAACCATTAGACATATCCGAGACCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 46.20% 0.32% 3.20% NA
All Indica  2759 26.40% 67.90% 0.47% 5.33% NA
All Japonica  1512 86.90% 12.90% 0.07% 0.13% NA
Aus  269 69.90% 29.70% 0.00% 0.37% NA
Indica I  595 14.50% 83.70% 0.34% 1.51% NA
Indica II  465 12.70% 85.20% 1.08% 1.08% NA
Indica III  913 33.60% 59.10% 0.22% 7.01% NA
Indica Intermediate  786 35.00% 55.70% 0.51% 8.78% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 69.00% 30.80% 0.00% 0.20% NA
Japonica Intermediate  241 85.90% 13.30% 0.41% 0.41% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 63.30% 35.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0718105499 A -> DEL N N silent_mutation Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0718105499 A -> G LOC_Os07g30590.1 upstream_gene_variant ; 1784.0bp to feature; MODIFIER silent_mutation Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0718105499 A -> G LOC_Os07g30600.1 upstream_gene_variant ; 726.0bp to feature; MODIFIER silent_mutation Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N
vg0718105499 A -> G LOC_Os07g30590-LOC_Os07g30600 intergenic_region ; MODIFIER silent_mutation Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0718105499 NA 3.06E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 3.35E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 9.63E-07 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 3.04E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 1.91E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 3.06E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 7.64E-06 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 1.09E-08 9.81E-12 mr1480_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 3.92E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 8.29E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0718105499 NA 1.46E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251