\
| Variant ID: vg0718105499 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 18105499 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.47, others allele: 0.00, population size: 94. )
TGGGTCTCGGATATGTCTAATGGTTGCTATAATTCCACCCGTCACAGGTAGGTGGCCACCTATATATGACGGGCCGCCATTTGCACCCCGACAGAGGTCG[A/G]
GTCTCGGACGATGACCTCACCTGTTATTACGACATTCTGTTGGACCTGCCACTGGTGAAGTCATCCATAACAAGCACTTTGGGCTATCACAGGTGGGCCG
CGGCCCACCTGTGATAGCCCAAAGTGCTTGTTATGGATGACTTCACCAGTGGCAGGTCCAACAGAATGTCGTAATAACAGGTGAGGTCATCGTCCGAGAC[T/C]
CGACCTCTGTCGGGGTGCAAATGGCGGCCCGTCATATATAGGTGGCCACCTACCTGTGACGGGTGGAATTATAGCAACCATTAGACATATCCGAGACCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.30% | 46.20% | 0.32% | 3.20% | NA |
| All Indica | 2759 | 26.40% | 67.90% | 0.47% | 5.33% | NA |
| All Japonica | 1512 | 86.90% | 12.90% | 0.07% | 0.13% | NA |
| Aus | 269 | 69.90% | 29.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 14.50% | 83.70% | 0.34% | 1.51% | NA |
| Indica II | 465 | 12.70% | 85.20% | 1.08% | 1.08% | NA |
| Indica III | 913 | 33.60% | 59.10% | 0.22% | 7.01% | NA |
| Indica Intermediate | 786 | 35.00% | 55.70% | 0.51% | 8.78% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 69.00% | 30.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 85.90% | 13.30% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0718105499 | A -> DEL | N | N | silent_mutation | Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| vg0718105499 | A -> G | LOC_Os07g30590.1 | upstream_gene_variant ; 1784.0bp to feature; MODIFIER | silent_mutation | Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| vg0718105499 | A -> G | LOC_Os07g30600.1 | upstream_gene_variant ; 726.0bp to feature; MODIFIER | silent_mutation | Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| vg0718105499 | A -> G | LOC_Os07g30590-LOC_Os07g30600 | intergenic_region ; MODIFIER | silent_mutation | Average:57.334; most accessible tissue: Zhenshan97 young leaf, score: 81.102 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0718105499 | NA | 3.06E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 3.35E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 9.63E-07 | mr1480 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 3.04E-06 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 1.91E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 3.06E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | 7.64E-06 | NA | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | 1.09E-08 | 9.81E-12 | mr1480_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 3.92E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 8.29E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0718105499 | NA | 1.46E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |