\
| Variant ID: vg0717900558 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17900558 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCAATGAATTATTCACATCACAAATTCTCAAAAAAATACAACTCAAATTCTTAAAGAAATACACCACAGATCCAAATATCAAATACATCACACATCATA[C/T]
ACATCACAGATCCAAACATCACAGATCCAATGAATCACAAGTTCTTAGATCCAAATGTATCACAAATTCGGAAAAAAAAAGAAAATTGTGCTTCCGCTGC
GCAGCGGAAGCACAATTTTCTTTTTTTTTCCGAATTTGTGATACATTTGGATCTAAGAACTTGTGATTCATTGGATCTGTGATGTTTGGATCTGTGATGT[G/A]
TATGATGTGTGATGTATTTGATATTTGGATCTGTGGTGTATTTCTTTAAGAATTTGAGTTGTATTTTTTTGAGAATTTGTGATGTGAATAATTCATTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 3.70% | 0.83% | 35.00% | NA |
| All Indica | 2759 | 50.80% | 0.10% | 1.38% | 47.73% | NA |
| All Japonica | 1512 | 73.30% | 10.50% | 0.07% | 16.07% | NA |
| Aus | 269 | 74.00% | 0.70% | 0.00% | 25.28% | NA |
| Indica I | 595 | 85.20% | 0.00% | 0.67% | 14.12% | NA |
| Indica II | 465 | 29.50% | 0.00% | 1.72% | 68.82% | NA |
| Indica III | 913 | 36.90% | 0.20% | 1.64% | 61.23% | NA |
| Indica Intermediate | 786 | 53.60% | 0.00% | 1.40% | 45.04% | NA |
| Temperate Japonica | 767 | 71.40% | 0.30% | 0.13% | 28.16% | NA |
| Tropical Japonica | 504 | 71.40% | 25.20% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 83.40% | 12.40% | 0.00% | 4.15% | NA |
| VI/Aromatic | 96 | 90.60% | 5.20% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 68.90% | 6.70% | 0.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717900558 | C -> DEL | N | N | silent_mutation | Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0717900558 | C -> T | LOC_Os07g30270.1 | upstream_gene_variant ; 2343.0bp to feature; MODIFIER | silent_mutation | Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0717900558 | C -> T | LOC_Os07g30280.1 | upstream_gene_variant ; 2082.0bp to feature; MODIFIER | silent_mutation | Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg0717900558 | C -> T | LOC_Os07g30270-LOC_Os07g30280 | intergenic_region ; MODIFIER | silent_mutation | Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717900558 | NA | 4.50E-06 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717900558 | NA | 5.72E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717900558 | NA | 1.56E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717900558 | 2.50E-06 | 2.83E-07 | mr1094_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717900558 | NA | 2.89E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |