\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717900558:

Variant ID: vg0717900558 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17900558
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCAATGAATTATTCACATCACAAATTCTCAAAAAAATACAACTCAAATTCTTAAAGAAATACACCACAGATCCAAATATCAAATACATCACACATCATA[C/T]
ACATCACAGATCCAAACATCACAGATCCAATGAATCACAAGTTCTTAGATCCAAATGTATCACAAATTCGGAAAAAAAAAGAAAATTGTGCTTCCGCTGC

Reverse complement sequence

GCAGCGGAAGCACAATTTTCTTTTTTTTTCCGAATTTGTGATACATTTGGATCTAAGAACTTGTGATTCATTGGATCTGTGATGTTTGGATCTGTGATGT[G/A]
TATGATGTGTGATGTATTTGATATTTGGATCTGTGGTGTATTTCTTTAAGAATTTGAGTTGTATTTTTTTGAGAATTTGTGATGTGAATAATTCATTGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 3.70% 0.83% 35.00% NA
All Indica  2759 50.80% 0.10% 1.38% 47.73% NA
All Japonica  1512 73.30% 10.50% 0.07% 16.07% NA
Aus  269 74.00% 0.70% 0.00% 25.28% NA
Indica I  595 85.20% 0.00% 0.67% 14.12% NA
Indica II  465 29.50% 0.00% 1.72% 68.82% NA
Indica III  913 36.90% 0.20% 1.64% 61.23% NA
Indica Intermediate  786 53.60% 0.00% 1.40% 45.04% NA
Temperate Japonica  767 71.40% 0.30% 0.13% 28.16% NA
Tropical Japonica  504 71.40% 25.20% 0.00% 3.37% NA
Japonica Intermediate  241 83.40% 12.40% 0.00% 4.15% NA
VI/Aromatic  96 90.60% 5.20% 0.00% 4.17% NA
Intermediate  90 68.90% 6.70% 0.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717900558 C -> DEL N N silent_mutation Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0717900558 C -> T LOC_Os07g30270.1 upstream_gene_variant ; 2343.0bp to feature; MODIFIER silent_mutation Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0717900558 C -> T LOC_Os07g30280.1 upstream_gene_variant ; 2082.0bp to feature; MODIFIER silent_mutation Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0717900558 C -> T LOC_Os07g30270-LOC_Os07g30280 intergenic_region ; MODIFIER silent_mutation Average:29.909; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717900558 NA 4.50E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717900558 NA 5.72E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717900558 NA 1.56E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717900558 2.50E-06 2.83E-07 mr1094_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717900558 NA 2.89E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251