Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717850162:

Variant ID: vg0717850162 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17850162
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TATTGTGCCTTCTGCGACCAACTGGAAGAGACAATCGACCACATTCTGATTGTGTGCCCGGAGTCCCTCCAGCTATGGTGGACTATCCTTTCGAGCCTCG[G/A]
TCTCCCTTAGTGTTTCCCCTCTGGCACTAATTCCTTCCATGAGTGGCACTGCTCTTGCCGGCTCAAAGTTCCGAGGGAGCGTCGTAGTGGGTTCGATACA

Reverse complement sequence

TGTATCGAACCCACTACGACGCTCCCTCGGAACTTTGAGCCGGCAAGAGCAGTGCCACTCATGGAAGGAATTAGTGCCAGAGGGGAAACACTAAGGGAGA[C/T]
CGAGGCTCGAAAGGATAGTCCACCATAGCTGGAGGGACTCCGGGCACACAATCAGAATGTGGTCGATTGTCTCTTCCAGTTGGTCGCAGAAGGCACAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.60%	3.70%	1.76%	0.95%	NA
All Indica	2759	93.70%	6.30%	0.00%	0.04%	NA
All Japonica	1512	91.70%	0.00%	5.42%	2.91%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	89.80%	10.20%	0.00%	0.00%	NA
Indica Intermediate	786	90.70%	9.20%	0.00%	0.13%	NA
Temperate Japonica	767	84.10%	0.00%	10.17%	5.74%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717850162	G -> DEL	N	N	silent_mutation	Average:76.556; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0717850162	G -> A	LOC_Os07g30210.1	upstream_gene_variant ; 1445.0bp to feature; MODIFIER	silent_mutation	Average:76.556; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0717850162	G -> A	LOC_Os07g30210.2	upstream_gene_variant ; 1445.0bp to feature; MODIFIER	silent_mutation	Average:76.556; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0717850162	G -> A	LOC_Os07g30220.1	downstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:76.556; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N
vg0717850162	G -> A	LOC_Os07g30210-LOC_Os07g30220	intergenic_region ; MODIFIER	silent_mutation	Average:76.556; most accessible tissue: Zhenshan97 young leaf, score: 86.698	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0717850162	G	A	-0.01	-0.02	-0.01	-0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717850162	NA	2.60E-07	mr1096	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	4.12E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	2.77E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	8.10E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	2.58E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	2.32E-09	mr1068_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	4.03E-08	mr1078_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	5.03E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	1.23E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	7.18E-07	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	1.15E-06	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	2.29E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	1.78E-07	mr1200_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	NA	3.75E-09	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	2.59E-07	3.50E-07	mr1265_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717850162	1.31E-08	1.43E-09	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251