\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717735595:

Variant ID: vg0717735595 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17735595
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TTGACCCCAAGTGCGGCTGCAGCTCTTATTGGTCGCCCTAAAGTTGAGGTGGATTGTGTGCTTGAATTGATCTCCGGAGGGAGACGTCAAGATAAATCCT[G/A]
CCCCAACTCCTTGGCTGTTGAGTGCACCATCGAACGCCATTGTCCACGTTTCGTTGTCGACTTGGTTGTCTGATTTGTTATCAGGCATAGTCCAATCGGC

Reverse complement sequence

GCCGATTGGACTATGCCTGATAACAAATCAGACAACCAAGTCGACAACGAAACGTGGACAATGGCGTTCGATGGTGCACTCAACAGCCAAGGAGTTGGGG[C/T]
AGGATTTATCTTGACGTCTCCCTCCGGAGATCAATTCAAGCACACAATCCACCTCAACTTTAGGGCGACCAATAAGAGCTGCAGCCGCACTTGGGGTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 39.40% 1.04% 0.02% NA
All Indica  2759 40.00% 58.40% 1.56% 0.04% NA
All Japonica  1512 89.90% 9.90% 0.20% 0.00% NA
Aus  269 73.20% 26.00% 0.74% 0.00% NA
Indica I  595 46.70% 50.30% 3.03% 0.00% NA
Indica II  465 17.60% 81.30% 1.08% 0.00% NA
Indica III  913 43.70% 56.00% 0.33% 0.00% NA
Indica Intermediate  786 43.80% 53.90% 2.16% 0.13% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 77.40% 22.20% 0.40% 0.00% NA
Japonica Intermediate  241 86.30% 13.30% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717735595 G -> DEL N N silent_mutation Average:27.652; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0717735595 G -> A LOC_Os07g30060.1 downstream_gene_variant ; 2303.0bp to feature; MODIFIER silent_mutation Average:27.652; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0717735595 G -> A LOC_Os07g30080.1 downstream_gene_variant ; 1466.0bp to feature; MODIFIER silent_mutation Average:27.652; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0717735595 G -> A LOC_Os07g30070.1 intron_variant ; MODIFIER silent_mutation Average:27.652; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717735595 NA 9.18E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 1.86E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 3.74E-07 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 1.18E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 4.68E-06 mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 4.38E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 8.85E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 2.25E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 8.02E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 7.33E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 8.73E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 3.34E-07 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 4.70E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 5.14E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 4.97E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 2.73E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 5.54E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 7.05E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 6.45E-08 mr1492_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 1.40E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 6.73E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 1.75E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 2.27E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 1.02E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 1.77E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 2.00E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 1.52E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 2.18E-06 2.17E-06 mr1766_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 5.74E-08 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 4.44E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 6.10E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717735595 NA 2.13E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251