Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717727644:

Variant ID: vg0717727644 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17727644
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTCAGTTTCCGATAGTTGTTCAGATTGCAGTATTTTCCGGAAAGTTGTTGCAGGATCTATAGTCCGTCAACCCAGGAAGAGTCAGCAAAGGATGGTCG[A/G]
AGAAGTGAAATGTCATGCCATGGAAAGGACCTCTTGAGTTGGATCTGTTAAGTGATCAGTGCTTGTTTCAAGGAATGTTAACTATGCAATCTGTTTAGGC

Reverse complement sequence

GCCTAAACAGATTGCATAGTTAACATTCCTTGAAACAAGCACTGATCACTTAACAGATCCAACTCAAGAGGTCCTTTCCATGGCATGACATTTCACTTCT[T/C]
CGACCATCCTTTGCTGACTCTTCCTGGGTTGACGGACTATAGATCCTGCAACAACTTTCCGGAAAATACTGCAATCTGAACAACTATCGGAAACTGACTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	7.80%	3.91%	4.78%	NA
All Indica	2759	77.90%	12.80%	5.76%	3.55%	NA
All Japonica	1512	91.60%	0.40%	1.65%	6.35%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	83.90%	10.10%	4.54%	1.51%	NA
Indica II	465	80.00%	12.90%	5.81%	1.29%	NA
Indica III	913	69.60%	17.40%	6.57%	6.46%	NA
Indica Intermediate	786	81.70%	9.50%	5.73%	3.05%	NA
Temperate Japonica	767	93.50%	0.00%	0.00%	6.52%	NA
Tropical Japonica	504	92.30%	1.20%	4.37%	2.18%	NA
Japonica Intermediate	241	84.20%	0.00%	1.24%	14.52%	NA
VI/Aromatic	96	65.60%	4.20%	1.04%	29.17%	NA
Intermediate	90	93.30%	4.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717727644	A -> DEL	N	N	silent_mutation	Average:9.182; most accessible tissue: Callus, score: 19.015	N	N	N	N
vg0717727644	A -> G	LOC_Os07g30060.1	upstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:9.182; most accessible tissue: Callus, score: 19.015	N	N	N	N
vg0717727644	A -> G	LOC_Os07g30050.1	downstream_gene_variant ; 978.0bp to feature; MODIFIER	silent_mutation	Average:9.182; most accessible tissue: Callus, score: 19.015	N	N	N	N
vg0717727644	A -> G	LOC_Os07g30050-LOC_Os07g30060	intergenic_region ; MODIFIER	silent_mutation	Average:9.182; most accessible tissue: Callus, score: 19.015	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717727644	NA	1.52E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	6.08E-06	3.59E-10	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	NA	3.12E-08	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	1.35E-14	4.31E-21	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	4.41E-12	2.22E-19	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	1.47E-06	1.72E-10	mr1538_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	NA	3.35E-10	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	NA	1.38E-09	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	1.57E-08	1.99E-27	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644	2.63E-06	2.10E-20	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251