\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717727644:

Variant ID: vg0717727644 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17727644
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGTCAGTTTCCGATAGTTGTTCAGATTGCAGTATTTTCCGGAAAGTTGTTGCAGGATCTATAGTCCGTCAACCCAGGAAGAGTCAGCAAAGGATGGTCG[A/G]
AGAAGTGAAATGTCATGCCATGGAAAGGACCTCTTGAGTTGGATCTGTTAAGTGATCAGTGCTTGTTTCAAGGAATGTTAACTATGCAATCTGTTTAGGC

Reverse complement sequence

GCCTAAACAGATTGCATAGTTAACATTCCTTGAAACAAGCACTGATCACTTAACAGATCCAACTCAAGAGGTCCTTTCCATGGCATGACATTTCACTTCT[T/C]
CGACCATCCTTTGCTGACTCTTCCTGGGTTGACGGACTATAGATCCTGCAACAACTTTCCGGAAAATACTGCAATCTGAACAACTATCGGAAACTGACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 7.80% 3.91% 4.78% NA
All Indica  2759 77.90% 12.80% 5.76% 3.55% NA
All Japonica  1512 91.60% 0.40% 1.65% 6.35% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 83.90% 10.10% 4.54% 1.51% NA
Indica II  465 80.00% 12.90% 5.81% 1.29% NA
Indica III  913 69.60% 17.40% 6.57% 6.46% NA
Indica Intermediate  786 81.70% 9.50% 5.73% 3.05% NA
Temperate Japonica  767 93.50% 0.00% 0.00% 6.52% NA
Tropical Japonica  504 92.30% 1.20% 4.37% 2.18% NA
Japonica Intermediate  241 84.20% 0.00% 1.24% 14.52% NA
VI/Aromatic  96 65.60% 4.20% 1.04% 29.17% NA
Intermediate  90 93.30% 4.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717727644 A -> DEL N N silent_mutation Average:9.182; most accessible tissue: Callus, score: 19.015 N N N N
vg0717727644 A -> G LOC_Os07g30060.1 upstream_gene_variant ; 3696.0bp to feature; MODIFIER silent_mutation Average:9.182; most accessible tissue: Callus, score: 19.015 N N N N
vg0717727644 A -> G LOC_Os07g30050.1 downstream_gene_variant ; 978.0bp to feature; MODIFIER silent_mutation Average:9.182; most accessible tissue: Callus, score: 19.015 N N N N
vg0717727644 A -> G LOC_Os07g30050-LOC_Os07g30060 intergenic_region ; MODIFIER silent_mutation Average:9.182; most accessible tissue: Callus, score: 19.015 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717727644 NA 1.52E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 6.08E-06 3.59E-10 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 NA 3.12E-08 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 1.35E-14 4.31E-21 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 4.41E-12 2.22E-19 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 1.47E-06 1.72E-10 mr1538_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 NA 3.35E-10 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 NA 1.38E-09 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 1.57E-08 1.99E-27 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727644 2.63E-06 2.10E-20 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251