\
| Variant ID: vg0717727644 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17727644 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGTCAGTTTCCGATAGTTGTTCAGATTGCAGTATTTTCCGGAAAGTTGTTGCAGGATCTATAGTCCGTCAACCCAGGAAGAGTCAGCAAAGGATGGTCG[A/G]
AGAAGTGAAATGTCATGCCATGGAAAGGACCTCTTGAGTTGGATCTGTTAAGTGATCAGTGCTTGTTTCAAGGAATGTTAACTATGCAATCTGTTTAGGC
GCCTAAACAGATTGCATAGTTAACATTCCTTGAAACAAGCACTGATCACTTAACAGATCCAACTCAAGAGGTCCTTTCCATGGCATGACATTTCACTTCT[T/C]
CGACCATCCTTTGCTGACTCTTCCTGGGTTGACGGACTATAGATCCTGCAACAACTTTCCGGAAAATACTGCAATCTGAACAACTATCGGAAACTGACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 7.80% | 3.91% | 4.78% | NA |
| All Indica | 2759 | 77.90% | 12.80% | 5.76% | 3.55% | NA |
| All Japonica | 1512 | 91.60% | 0.40% | 1.65% | 6.35% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 83.90% | 10.10% | 4.54% | 1.51% | NA |
| Indica II | 465 | 80.00% | 12.90% | 5.81% | 1.29% | NA |
| Indica III | 913 | 69.60% | 17.40% | 6.57% | 6.46% | NA |
| Indica Intermediate | 786 | 81.70% | 9.50% | 5.73% | 3.05% | NA |
| Temperate Japonica | 767 | 93.50% | 0.00% | 0.00% | 6.52% | NA |
| Tropical Japonica | 504 | 92.30% | 1.20% | 4.37% | 2.18% | NA |
| Japonica Intermediate | 241 | 84.20% | 0.00% | 1.24% | 14.52% | NA |
| VI/Aromatic | 96 | 65.60% | 4.20% | 1.04% | 29.17% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717727644 | A -> DEL | N | N | silent_mutation | Average:9.182; most accessible tissue: Callus, score: 19.015 | N | N | N | N |
| vg0717727644 | A -> G | LOC_Os07g30060.1 | upstream_gene_variant ; 3696.0bp to feature; MODIFIER | silent_mutation | Average:9.182; most accessible tissue: Callus, score: 19.015 | N | N | N | N |
| vg0717727644 | A -> G | LOC_Os07g30050.1 | downstream_gene_variant ; 978.0bp to feature; MODIFIER | silent_mutation | Average:9.182; most accessible tissue: Callus, score: 19.015 | N | N | N | N |
| vg0717727644 | A -> G | LOC_Os07g30050-LOC_Os07g30060 | intergenic_region ; MODIFIER | silent_mutation | Average:9.182; most accessible tissue: Callus, score: 19.015 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717727644 | NA | 1.52E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | 6.08E-06 | 3.59E-10 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | NA | 3.12E-08 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | 1.35E-14 | 4.31E-21 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | 4.41E-12 | 2.22E-19 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | 1.47E-06 | 1.72E-10 | mr1538_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | NA | 3.35E-10 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | NA | 1.38E-09 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | 1.57E-08 | 1.99E-27 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727644 | 2.63E-06 | 2.10E-20 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |