\
| Variant ID: vg0717727326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17727326 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TGAAAGTGACATCATATAAAGAATCTTGGGAACTCTCTAACCTTGGAAGCTGTTACAGGATGGTAATCGGCAATTACGCCCTAGTGGTGTGATCATGAAT[T/C]
CAGTATAAGTTCCAGGAATCATCTCAATGTTTCTCAAAAGTTGAAAAAAGAAATTGTTCCATACATGAGTCAGGAAGATACAAGAGTTTGGTCCAGAAAT
ATTTCTGGACCAAACTCTTGTATCTTCCTGACTCATGTATGGAACAATTTCTTTTTTCAACTTTTGAGAAACATTGAGATGATTCCTGGAACTTATACTG[A/G]
ATTCATGATCACACCACTAGGGCGTAATTGCCGATTACCATCCTGTAACAGCTTCCAAGGTTAGAGAGTTCCCAAGATTCTTTATATGATGTCACTTTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 10.90% | 21.41% | 4.36% | NA |
| All Indica | 2759 | 45.70% | 18.60% | 31.39% | 4.31% | NA |
| All Japonica | 1512 | 90.50% | 0.10% | 5.22% | 4.10% | NA |
| Aus | 269 | 75.10% | 0.00% | 18.59% | 6.32% | NA |
| Indica I | 595 | 59.20% | 13.30% | 21.68% | 5.88% | NA |
| Indica II | 465 | 23.70% | 18.50% | 50.97% | 6.88% | NA |
| Indica III | 913 | 44.50% | 25.60% | 28.70% | 1.20% | NA |
| Indica Intermediate | 786 | 50.00% | 14.50% | 30.28% | 5.22% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 78.60% | 0.40% | 15.08% | 5.95% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.00% | 0.41% | 12.03% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 4.17% | 1.04% | NA |
| Intermediate | 90 | 75.60% | 2.20% | 14.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717727326 | T -> DEL | N | N | silent_mutation | Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0717727326 | T -> C | LOC_Os07g30060.1 | upstream_gene_variant ; 4014.0bp to feature; MODIFIER | silent_mutation | Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0717727326 | T -> C | LOC_Os07g30050.1 | downstream_gene_variant ; 660.0bp to feature; MODIFIER | silent_mutation | Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| vg0717727326 | T -> C | LOC_Os07g30050-LOC_Os07g30060 | intergenic_region ; MODIFIER | silent_mutation | Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717727326 | 1.11E-07 | 3.80E-12 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 1.95E-06 | 5.90E-10 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 5.31E-16 | 2.14E-22 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 1.46E-13 | 3.68E-21 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 5.41E-07 | 6.63E-10 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 3.13E-08 | 5.69E-13 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 2.36E-08 | 5.26E-13 | mr1547_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 2.14E-14 | 2.85E-31 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717727326 | 2.96E-10 | 5.07E-24 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |