\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717727326:

Variant ID: vg0717727326 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17727326
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGTGACATCATATAAAGAATCTTGGGAACTCTCTAACCTTGGAAGCTGTTACAGGATGGTAATCGGCAATTACGCCCTAGTGGTGTGATCATGAAT[T/C]
CAGTATAAGTTCCAGGAATCATCTCAATGTTTCTCAAAAGTTGAAAAAAGAAATTGTTCCATACATGAGTCAGGAAGATACAAGAGTTTGGTCCAGAAAT

Reverse complement sequence

ATTTCTGGACCAAACTCTTGTATCTTCCTGACTCATGTATGGAACAATTTCTTTTTTCAACTTTTGAGAAACATTGAGATGATTCCTGGAACTTATACTG[A/G]
ATTCATGATCACACCACTAGGGCGTAATTGCCGATTACCATCCTGTAACAGCTTCCAAGGTTAGAGAGTTCCCAAGATTCTTTATATGATGTCACTTTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 10.90% 21.41% 4.36% NA
All Indica  2759 45.70% 18.60% 31.39% 4.31% NA
All Japonica  1512 90.50% 0.10% 5.22% 4.10% NA
Aus  269 75.10% 0.00% 18.59% 6.32% NA
Indica I  595 59.20% 13.30% 21.68% 5.88% NA
Indica II  465 23.70% 18.50% 50.97% 6.88% NA
Indica III  913 44.50% 25.60% 28.70% 1.20% NA
Indica Intermediate  786 50.00% 14.50% 30.28% 5.22% NA
Temperate Japonica  767 99.30% 0.00% 0.26% 0.39% NA
Tropical Japonica  504 78.60% 0.40% 15.08% 5.95% NA
Japonica Intermediate  241 87.60% 0.00% 0.41% 12.03% NA
VI/Aromatic  96 94.80% 0.00% 4.17% 1.04% NA
Intermediate  90 75.60% 2.20% 14.44% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717727326 T -> DEL N N silent_mutation Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0717727326 T -> C LOC_Os07g30060.1 upstream_gene_variant ; 4014.0bp to feature; MODIFIER silent_mutation Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0717727326 T -> C LOC_Os07g30050.1 downstream_gene_variant ; 660.0bp to feature; MODIFIER silent_mutation Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg0717727326 T -> C LOC_Os07g30050-LOC_Os07g30060 intergenic_region ; MODIFIER silent_mutation Average:22.717; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717727326 1.11E-07 3.80E-12 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 1.95E-06 5.90E-10 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 5.31E-16 2.14E-22 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 1.46E-13 3.68E-21 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 5.41E-07 6.63E-10 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 3.13E-08 5.69E-13 mr1547_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 2.36E-08 5.26E-13 mr1547_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 2.14E-14 2.85E-31 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717727326 2.96E-10 5.07E-24 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251