RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0717726119:

Variant ID: vg0717726119 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17726119
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GTCATAGCTAAGACCAAGAAAGAACAAGGGACAACCGTGCAACCCATTCGTCGACCAATGGCAGACGACAACAGCAGTCACAATCCTTCTGCTCTTCCTC[C/A]
AACTCCAGCTCCAGCGGAAGCCAACCATGGAAGAAGCAACATCGCCAGGGATGTTCAGAAATCACTGCTTGTTCCAGTTTCAGCTGCCAAAGTGCACAAT

Reverse complement sequence

ATTGTGCACTTTGGCAGCTGAAACTGGAACAAGCAGTGATTTCTGAACATCCCTGGCGATGTTGCTTCTTCCATGGTTGGCTTCCGCTGGAGCTGGAGTT[G/T]
GAGGAAGAGCAGAAGGATTGTGACTGCTGTTGTCGTCTGCCATTGGTCGACGAATGGGTTGCACGGTTGTCCCTTGTTCTTTCTTGGTCTTAGCTATGAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.10%	11.70%	7.43%	8.82%	NA
All Indica	2759	59.10%	19.80%	11.16%	9.97%	NA
All Japonica	1512	92.30%	0.10%	0.99%	6.61%	NA
Aus	269	79.60%	0.00%	7.06%	13.38%	NA
Indica I	595	62.50%	16.60%	9.92%	10.92%	NA
Indica II	465	66.70%	19.40%	9.89%	4.09%	NA
Indica III	913	47.30%	25.80%	13.36%	13.47%	NA
Indica Intermediate	786	65.60%	15.40%	10.31%	8.65%	NA
Temperate Japonica	767	99.50%	0.00%	0.39%	0.13%	NA
Tropical Japonica	504	82.90%	0.40%	1.59%	15.08%	NA
Japonica Intermediate	241	88.80%	0.00%	1.66%	9.54%	NA
VI/Aromatic	96	95.80%	0.00%	2.08%	2.08%	NA
Intermediate	90	84.40%	3.30%	7.78%	4.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717726119	C -> DEL	LOC_Os07g30050.1	N	frameshift_variant	Average:17.07; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg0717726119	C -> A	LOC_Os07g30050.1	missense_variant ; p.Pro333Gln; MODERATE	nonsynonymous_codon ; P333Q	Average:17.07; most accessible tissue: Minghui63 young leaf, score: 29.964	unknown	unknown	DELETERIOUS	0.01

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717726119	1.28E-07	1.34E-11	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	2.80E-06	2.20E-09	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	2.91E-14	1.57E-24	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	7.99E-12	6.66E-23	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	NA	1.30E-09	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	1.17E-06	1.72E-11	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	3.92E-06	4.73E-11	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	3.46E-12	2.02E-37	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717726119	7.93E-09	2.19E-28	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0717726119:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact