\
| Variant ID: vg0717726119 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17726119 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 80. )
GTCATAGCTAAGACCAAGAAAGAACAAGGGACAACCGTGCAACCCATTCGTCGACCAATGGCAGACGACAACAGCAGTCACAATCCTTCTGCTCTTCCTC[C/A]
AACTCCAGCTCCAGCGGAAGCCAACCATGGAAGAAGCAACATCGCCAGGGATGTTCAGAAATCACTGCTTGTTCCAGTTTCAGCTGCCAAAGTGCACAAT
ATTGTGCACTTTGGCAGCTGAAACTGGAACAAGCAGTGATTTCTGAACATCCCTGGCGATGTTGCTTCTTCCATGGTTGGCTTCCGCTGGAGCTGGAGTT[G/T]
GAGGAAGAGCAGAAGGATTGTGACTGCTGTTGTCGTCTGCCATTGGTCGACGAATGGGTTGCACGGTTGTCCCTTGTTCTTTCTTGGTCTTAGCTATGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.10% | 11.70% | 7.43% | 8.82% | NA |
| All Indica | 2759 | 59.10% | 19.80% | 11.16% | 9.97% | NA |
| All Japonica | 1512 | 92.30% | 0.10% | 0.99% | 6.61% | NA |
| Aus | 269 | 79.60% | 0.00% | 7.06% | 13.38% | NA |
| Indica I | 595 | 62.50% | 16.60% | 9.92% | 10.92% | NA |
| Indica II | 465 | 66.70% | 19.40% | 9.89% | 4.09% | NA |
| Indica III | 913 | 47.30% | 25.80% | 13.36% | 13.47% | NA |
| Indica Intermediate | 786 | 65.60% | 15.40% | 10.31% | 8.65% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.39% | 0.13% | NA |
| Tropical Japonica | 504 | 82.90% | 0.40% | 1.59% | 15.08% | NA |
| Japonica Intermediate | 241 | 88.80% | 0.00% | 1.66% | 9.54% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 84.40% | 3.30% | 7.78% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717726119 | C -> DEL | LOC_Os07g30050.1 | N | frameshift_variant | Average:17.07; most accessible tissue: Minghui63 young leaf, score: 29.964 | N | N | N | N |
| vg0717726119 | C -> A | LOC_Os07g30050.1 | missense_variant ; p.Pro333Gln; MODERATE | nonsynonymous_codon ; P333Q | Average:17.07; most accessible tissue: Minghui63 young leaf, score: 29.964 | unknown | unknown | DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717726119 | 1.28E-07 | 1.34E-11 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | 2.80E-06 | 2.20E-09 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | 2.91E-14 | 1.57E-24 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | 7.99E-12 | 6.66E-23 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | NA | 1.30E-09 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | 1.17E-06 | 1.72E-11 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | 3.92E-06 | 4.73E-11 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | 3.46E-12 | 2.02E-37 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717726119 | 7.93E-09 | 2.19E-28 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |