\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717669062:

Variant ID: vg0717669062 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17669062
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, C: 0.48, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTCGTTCATCTTCTTGTCTCCAATCTCCGTTGACATCTTGGTGAAGGTGCCGATGCAGCAGCAGTAGCCACGAAGAACAAGAGCAGTCGCGCTTGAAG[T/C]
GCTATCCAAAAACTTGATCGCCCGCCTACCCGTGCAAGTTCTCAAGCGGACGGAGTTCCGGAGGCACCTGCTCGTCCCATACACCTGTGCACGCAGGTGA

Reverse complement sequence

TCACCTGCGTGCACAGGTGTATGGGACGAGCAGGTGCCTCCGGAACTCCGTCCGCTTGAGAACTTGCACGGGTAGGCGGGCGATCAAGTTTTTGGATAGC[A/G]
CTTCAAGCGCGACTGCTCTTGTTCTTCGTGGCTACTGCTGCTGCATCGGCACCTTCACCAAGATGTCAACGGAGATTGGAGACAAGAAGATGAACGACAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.20% 0.17% 0.00% NA
All Indica  2759 40.60% 59.20% 0.18% 0.00% NA
All Japonica  1512 89.60% 10.30% 0.13% 0.00% NA
Aus  269 71.40% 28.30% 0.37% 0.00% NA
Indica I  595 47.40% 52.60% 0.00% 0.00% NA
Indica II  465 17.00% 82.60% 0.43% 0.00% NA
Indica III  913 42.70% 57.10% 0.22% 0.00% NA
Indica Intermediate  786 47.10% 52.80% 0.13% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 77.00% 22.60% 0.40% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717669062 T -> C LOC_Os07g29990.1 downstream_gene_variant ; 1312.0bp to feature; MODIFIER silent_mutation Average:37.017; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0717669062 T -> C LOC_Os07g30000.1 downstream_gene_variant ; 1211.0bp to feature; MODIFIER silent_mutation Average:37.017; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0717669062 T -> C LOC_Os07g29990-LOC_Os07g30000 intergenic_region ; MODIFIER silent_mutation Average:37.017; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717669062 NA 5.96E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 5.43E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 6.52E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 6.57E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 7.44E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 1.75E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 2.74E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 3.06E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 8.96E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 5.39E-06 5.41E-06 mr1983_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 2.44E-06 2.43E-06 mr1983_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717669062 NA 7.92E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251