\
| Variant ID: vg0717669062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17669062 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.52, C: 0.48, others allele: 0.00, population size: 103. )
ATGTCGTTCATCTTCTTGTCTCCAATCTCCGTTGACATCTTGGTGAAGGTGCCGATGCAGCAGCAGTAGCCACGAAGAACAAGAGCAGTCGCGCTTGAAG[T/C]
GCTATCCAAAAACTTGATCGCCCGCCTACCCGTGCAAGTTCTCAAGCGGACGGAGTTCCGGAGGCACCTGCTCGTCCCATACACCTGTGCACGCAGGTGA
TCACCTGCGTGCACAGGTGTATGGGACGAGCAGGTGCCTCCGGAACTCCGTCCGCTTGAGAACTTGCACGGGTAGGCGGGCGATCAAGTTTTTGGATAGC[A/G]
CTTCAAGCGCGACTGCTCTTGTTCTTCGTGGCTACTGCTGCTGCATCGGCACCTTCACCAAGATGTCAACGGAGATTGGAGACAAGAAGATGAACGACAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 40.20% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 40.60% | 59.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 10.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 71.40% | 28.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 47.40% | 52.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 17.00% | 82.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 42.70% | 57.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 47.10% | 52.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.00% | 22.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717669062 | T -> C | LOC_Os07g29990.1 | downstream_gene_variant ; 1312.0bp to feature; MODIFIER | silent_mutation | Average:37.017; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0717669062 | T -> C | LOC_Os07g30000.1 | downstream_gene_variant ; 1211.0bp to feature; MODIFIER | silent_mutation | Average:37.017; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0717669062 | T -> C | LOC_Os07g29990-LOC_Os07g30000 | intergenic_region ; MODIFIER | silent_mutation | Average:37.017; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717669062 | NA | 5.96E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 5.43E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 6.52E-07 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 6.57E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 7.44E-06 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 1.75E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 2.74E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 3.06E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 8.96E-09 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | 5.39E-06 | 5.41E-06 | mr1983_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | 2.44E-06 | 2.43E-06 | mr1983_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717669062 | NA | 7.92E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |