Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717601432:

Variant ID: vg0717601432 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17601432
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTCTTCCATTTTAACCATCTACATACTCCATAGATTATATTTTCGCAATCGGTTAGCACTACCATGCCACCCTCTGGGCTGCCGACGTGAGCTCGACC[G/A]
CCGCCAATGGAGGCGCTTGTCGGCAAGTACCTTCCACACCTTGCCGAAGGTTGGCAAACTACCTAAACCCTTCTAAGTACATCGTAGATGCTCTAGGAAC

Reverse complement sequence

GTTCCTAGAGCATCTACGATGTACTTAGAAGGGTTTAGGTAGTTTGCCAACCTTCGGCAAGGTGTGGAAGGTACTTGCCGACAAGCGCCTCCATTGGCGG[C/T]
GGTCGAGCTCACGTCGGCAGCCCAGAGGGTGGCATGGTAGTGCTAACCGATTGCGAAAATATAATCTATGGAGTATGTAGATGGTTAAAATGGAAGAACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.90%	5.20%	1.95%	26.96%	NA
All Indica	2759	50.20%	8.50%	2.94%	38.35%	NA
All Japonica	1512	90.50%	0.00%	0.33%	9.13%	NA
Aus	269	77.30%	3.30%	1.12%	18.22%	NA
Indica I	595	52.40%	7.10%	0.67%	39.83%	NA
Indica II	465	39.60%	9.00%	7.10%	44.30%	NA
Indica III	913	50.60%	10.20%	2.52%	36.69%	NA
Indica Intermediate	786	54.30%	7.40%	2.67%	35.62%	NA
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	79.40%	0.00%	0.60%	20.04%	NA
Japonica Intermediate	241	85.90%	0.00%	0.83%	13.28%	NA
VI/Aromatic	96	88.50%	0.00%	1.04%	10.42%	NA
Intermediate	90	75.60%	1.10%	2.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717601432	G -> DEL	N	N	silent_mutation	Average:25.037; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0717601432	G -> A	LOC_Os07g29910.1	upstream_gene_variant ; 2181.0bp to feature; MODIFIER	silent_mutation	Average:25.037; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0717601432	G -> A	LOC_Os07g29900-LOC_Os07g29910	intergenic_region ; MODIFIER	silent_mutation	Average:25.037; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717601432	1.13E-10	1.29E-09	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601432	4.79E-09	1.67E-09	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601432	NA	1.55E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601432	NA	3.00E-07	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601432	1.02E-07	6.94E-09	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601432	1.15E-07	7.66E-10	mr1547_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601432	NA	5.04E-08	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251