\
| Variant ID: vg0717601057 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17601057 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCCGAGCTCATCCACTTCTTCTTGCCCTATAAATAGGACCCCAAGCCCTTCCTTGTCCATCATCGATCATCACCAACCATAACCCCACAACCCCGAAGC[T/C]
CTGCTTTGCCAATCCATCTCATCAACCATCCTCGCCCGTCAATCGAACACCTTGTGCATGATCGACTATACACCTCTCCATCCACTCTCCACCCTAACCA
TGGTTAGGGTGGAGAGTGGATGGAGAGGTGTATAGTCGATCATGCACAAGGTGTTCGATTGACGGGCGAGGATGGTTGATGAGATGGATTGGCAAAGCAG[A/G]
GCTTCGGGGTTGTGGGGTTATGGTTGGTGATGATCGATGATGGACAAGGAAGGGCTTGGGGTCCTATTTATAGGGCAAGAAGAAGTGGATGAGCTCGGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.30% | 4.80% | 3.22% | 22.62% | NA |
| All Indica | 2759 | 56.30% | 7.60% | 4.82% | 31.24% | NA |
| All Japonica | 1512 | 89.90% | 0.10% | 0.13% | 9.85% | NA |
| Aus | 269 | 77.30% | 5.60% | 4.83% | 12.27% | NA |
| Indica I | 595 | 62.20% | 0.50% | 2.52% | 34.79% | NA |
| Indica II | 465 | 42.80% | 15.50% | 5.81% | 35.91% | NA |
| Indica III | 913 | 55.80% | 10.50% | 5.91% | 27.82% | NA |
| Indica Intermediate | 786 | 60.40% | 5.10% | 4.71% | 29.77% | NA |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 77.60% | 0.40% | 0.40% | 21.63% | NA |
| Japonica Intermediate | 241 | 85.50% | 0.00% | 0.00% | 14.52% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 73.30% | 1.10% | 4.44% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717601057 | T -> DEL | N | N | silent_mutation | Average:15.302; most accessible tissue: Callus, score: 44.213 | N | N | N | N |
| vg0717601057 | T -> C | LOC_Os07g29910.1 | upstream_gene_variant ; 2556.0bp to feature; MODIFIER | silent_mutation | Average:15.302; most accessible tissue: Callus, score: 44.213 | N | N | N | N |
| vg0717601057 | T -> C | LOC_Os07g29900-LOC_Os07g29910 | intergenic_region ; MODIFIER | silent_mutation | Average:15.302; most accessible tissue: Callus, score: 44.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717601057 | 1.53E-06 | 8.33E-08 | mr1121 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717601057 | NA | 1.87E-08 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717601057 | NA | 3.97E-07 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717601057 | NA | 1.04E-07 | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717601057 | NA | 9.06E-08 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717601057 | NA | 1.13E-07 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717601057 | NA | 9.22E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |