\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717601057:

Variant ID: vg0717601057 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17601057
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCCGAGCTCATCCACTTCTTCTTGCCCTATAAATAGGACCCCAAGCCCTTCCTTGTCCATCATCGATCATCACCAACCATAACCCCACAACCCCGAAGC[T/C]
CTGCTTTGCCAATCCATCTCATCAACCATCCTCGCCCGTCAATCGAACACCTTGTGCATGATCGACTATACACCTCTCCATCCACTCTCCACCCTAACCA

Reverse complement sequence

TGGTTAGGGTGGAGAGTGGATGGAGAGGTGTATAGTCGATCATGCACAAGGTGTTCGATTGACGGGCGAGGATGGTTGATGAGATGGATTGGCAAAGCAG[A/G]
GCTTCGGGGTTGTGGGGTTATGGTTGGTGATGATCGATGATGGACAAGGAAGGGCTTGGGGTCCTATTTATAGGGCAAGAAGAAGTGGATGAGCTCGGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 4.80% 3.22% 22.62% NA
All Indica  2759 56.30% 7.60% 4.82% 31.24% NA
All Japonica  1512 89.90% 0.10% 0.13% 9.85% NA
Aus  269 77.30% 5.60% 4.83% 12.27% NA
Indica I  595 62.20% 0.50% 2.52% 34.79% NA
Indica II  465 42.80% 15.50% 5.81% 35.91% NA
Indica III  913 55.80% 10.50% 5.91% 27.82% NA
Indica Intermediate  786 60.40% 5.10% 4.71% 29.77% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 77.60% 0.40% 0.40% 21.63% NA
Japonica Intermediate  241 85.50% 0.00% 0.00% 14.52% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 73.30% 1.10% 4.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717601057 T -> DEL N N silent_mutation Average:15.302; most accessible tissue: Callus, score: 44.213 N N N N
vg0717601057 T -> C LOC_Os07g29910.1 upstream_gene_variant ; 2556.0bp to feature; MODIFIER silent_mutation Average:15.302; most accessible tissue: Callus, score: 44.213 N N N N
vg0717601057 T -> C LOC_Os07g29900-LOC_Os07g29910 intergenic_region ; MODIFIER silent_mutation Average:15.302; most accessible tissue: Callus, score: 44.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717601057 1.53E-06 8.33E-08 mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057 NA 1.87E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057 NA 3.97E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057 NA 1.04E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057 NA 9.06E-08 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057 NA 1.13E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717601057 NA 9.22E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251