\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717539471:

Variant ID: vg0717539471 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17539471
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGCCAGCCGATCGACGCAGCAGCGTGTATGGGGTACTGCCCTTGGTTGTCCGGCTGGTACGCCGTGGACACGTTGGCATCCGGCAGCAGCCTGGTAGC[C/T]
GATGGCCCTGCCGACATCGACCCTAGGGACGGCAGCCCAGCCATAGATGCGGCCAAGTGAAGAGGGGTGCTCCCGTTGTCATTGTCCCTCTGGCTAGTGA

Reverse complement sequence

TCACTAGCCAGAGGGACAATGACAACGGGAGCACCCCTCTTCACTTGGCCGCATCTATGGCTGGGCTGCCGTCCCTAGGGTCGATGTCGGCAGGGCCATC[G/A]
GCTACCAGGCTGCTGCCGGATGCCAACGTGTCCACGGCGTACCAGCCGGACAACCAAGGGCAGTACCCCATACACGCTGCTGCGTCGATCGGCTGGCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 35.00% 1.08% 0.04% NA
All Indica  2759 41.80% 56.30% 1.78% 0.07% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 72.50% 26.80% 0.74% 0.00% NA
Indica I  595 46.60% 51.30% 2.18% 0.00% NA
Indica II  465 17.40% 81.50% 0.65% 0.43% NA
Indica III  913 46.30% 51.30% 2.41% 0.00% NA
Indica Intermediate  786 47.50% 51.10% 1.40% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717539471 C -> DEL N N silent_mutation Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0717539471 C -> T LOC_Os07g29820.1 upstream_gene_variant ; 4385.0bp to feature; MODIFIER silent_mutation Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0717539471 C -> T LOC_Os07g29830.1 upstream_gene_variant ; 101.0bp to feature; MODIFIER silent_mutation Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0717539471 C -> T LOC_Os07g29830-LOC_Os07g29850 intergenic_region ; MODIFIER silent_mutation Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717539471 NA 3.30E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 2.64E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 3.17E-06 NA mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 9.13E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 2.52E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 4.99E-06 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 6.27E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 6.57E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 1.79E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 1.73E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 4.26E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 5.00E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471 NA 3.24E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251