Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717539471:

Variant ID: vg0717539471 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17539471
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

GCTGCCAGCCGATCGACGCAGCAGCGTGTATGGGGTACTGCCCTTGGTTGTCCGGCTGGTACGCCGTGGACACGTTGGCATCCGGCAGCAGCCTGGTAGC[C/T]
GATGGCCCTGCCGACATCGACCCTAGGGACGGCAGCCCAGCCATAGATGCGGCCAAGTGAAGAGGGGTGCTCCCGTTGTCATTGTCCCTCTGGCTAGTGA

Reverse complement sequence

TCACTAGCCAGAGGGACAATGACAACGGGAGCACCCCTCTTCACTTGGCCGCATCTATGGCTGGGCTGCCGTCCCTAGGGTCGATGTCGGCAGGGCCATC[G/A]
GCTACCAGGCTGCTGCCGGATGCCAACGTGTCCACGGCGTACCAGCCGGACAACCAAGGGCAGTACCCCATACACGCTGCTGCGTCGATCGGCTGGCAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.90%	35.00%	1.08%	0.04%	NA
All Indica	2759	41.80%	56.30%	1.78%	0.07%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	72.50%	26.80%	0.74%	0.00%	NA
Indica I	595	46.60%	51.30%	2.18%	0.00%	NA
Indica II	465	17.40%	81.50%	0.65%	0.43%	NA
Indica III	913	46.30%	51.30%	2.41%	0.00%	NA
Indica Intermediate	786	47.50%	51.10%	1.40%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717539471	C -> DEL	N	N	silent_mutation	Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0717539471	C -> T	LOC_Os07g29820.1	upstream_gene_variant ; 4385.0bp to feature; MODIFIER	silent_mutation	Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0717539471	C -> T	LOC_Os07g29830.1	upstream_gene_variant ; 101.0bp to feature; MODIFIER	silent_mutation	Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N
vg0717539471	C -> T	LOC_Os07g29830-LOC_Os07g29850	intergenic_region ; MODIFIER	silent_mutation	Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717539471	NA	3.30E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	2.64E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	3.17E-06	NA	mr1188_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	9.13E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	2.52E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	4.99E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	6.27E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	6.57E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	1.79E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	1.73E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	4.26E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	5.00E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717539471	NA	3.24E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251