\
| Variant ID: vg0717539471 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17539471 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )
GCTGCCAGCCGATCGACGCAGCAGCGTGTATGGGGTACTGCCCTTGGTTGTCCGGCTGGTACGCCGTGGACACGTTGGCATCCGGCAGCAGCCTGGTAGC[C/T]
GATGGCCCTGCCGACATCGACCCTAGGGACGGCAGCCCAGCCATAGATGCGGCCAAGTGAAGAGGGGTGCTCCCGTTGTCATTGTCCCTCTGGCTAGTGA
TCACTAGCCAGAGGGACAATGACAACGGGAGCACCCCTCTTCACTTGGCCGCATCTATGGCTGGGCTGCCGTCCCTAGGGTCGATGTCGGCAGGGCCATC[G/A]
GCTACCAGGCTGCTGCCGGATGCCAACGTGTCCACGGCGTACCAGCCGGACAACCAAGGGCAGTACCCCATACACGCTGCTGCGTCGATCGGCTGGCAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 35.00% | 1.08% | 0.04% | NA |
| All Indica | 2759 | 41.80% | 56.30% | 1.78% | 0.07% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 72.50% | 26.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 46.60% | 51.30% | 2.18% | 0.00% | NA |
| Indica II | 465 | 17.40% | 81.50% | 0.65% | 0.43% | NA |
| Indica III | 913 | 46.30% | 51.30% | 2.41% | 0.00% | NA |
| Indica Intermediate | 786 | 47.50% | 51.10% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717539471 | C -> DEL | N | N | silent_mutation | Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0717539471 | C -> T | LOC_Os07g29820.1 | upstream_gene_variant ; 4385.0bp to feature; MODIFIER | silent_mutation | Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0717539471 | C -> T | LOC_Os07g29830.1 | upstream_gene_variant ; 101.0bp to feature; MODIFIER | silent_mutation | Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0717539471 | C -> T | LOC_Os07g29830-LOC_Os07g29850 | intergenic_region ; MODIFIER | silent_mutation | Average:63.101; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717539471 | NA | 3.30E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 2.64E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | 3.17E-06 | NA | mr1188_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 9.13E-07 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 2.52E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 4.99E-06 | mr1294_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 6.27E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 6.57E-06 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 1.79E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 1.73E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 4.26E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 5.00E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717539471 | NA | 3.24E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |