Search for Variation information by Variation ID:
Detailed information for vg0717527954:
| Variant ID: vg0717527954 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17527954 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 345. )
Flanking Sequence (100 bp) in Reference Genome:
CCTGATCACTCTGTTGAGATAAGCTCTCAAATTGGTGTGTCTAGAGTACCTATGAACCGAATATCCACACTGAGGTGGGTCGTAAGGAGTTACCTTGTTC[C/T]
GTACCTTATCATGGTTATGGTTGTTATGCAATTTCTTTCGTATTATCTACACAACAGGTCAACTAGGGAGATCTGGCTGGTTCAGACCCTTTTCATCTTC
Reverse complement sequence
GAAGATGAAAAGGGTCTGAACCAGCCAGATCTCCCTAGTTGACCTGTTGTGTAGATAATACGAAAGAAATTGCATAACAACCATAACCATGATAAGGTAC[G/A]
GAACAAGGTAACTCCTTACGACCCACCTCAGTGTGGATATTCGGTTCATAGGTACTCTAGACACACCAATTTGAGAGCTTATCTCAACAGAGTGATCAGG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 8.90% | 1.33% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 69.90% | 26.20% | 3.90% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 87.50% | 8.60% | 3.91% | 0.00% | NA |
| Tropical Japonica | 504 | 52.40% | 44.80% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 43.20% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 2.22% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717527954 | C -> T | LOC_Os07g29810.1 | missense_variant ; p.Pro1076Leu; MODERATE | nonsynonymous_codon ; P1076L | Average:76.083; most accessible tissue: Callus, score: 86.689 | possibly damaging  |
1.728 |
TOLERATED | 0.33 |
Effects Predicted by Deep Convolutional Neural Networks
For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.
| Var ID | Ref | Alt | Root (RT) | Young Leaf (YL) | Flag Leaf (FL) | Young Panicle (YP) | Lemma & Palea (LP) | Stamen & Pistil (SP) |
|---|---|---|---|---|---|---|---|---|
| vg0717527954 | C | T | 0.01 | 0.0 | 0.0 | 0.01 | 0.0 | 0.0 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717527954 | NA | 2.85E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | 1.93E-06 | 2.18E-13 | mr1751 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 1.75E-06 | mr1751 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 8.41E-06 | mr1088_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 4.38E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 6.19E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 1.25E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 4.47E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 2.80E-06 | mr1620_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 1.10E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 5.25E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717527954 | NA | 1.21E-19 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |