Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717522436:

Variant ID: vg0717522436 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17522436
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTAAGAATAATATCATACATAGATGTCATCAAGCTAAGAGCATCCGTTTTATGTTGAAAATCAAAGATAAACCAAACTAGTCTACTAAAGCAACAGTG[C/A]
AAAAAGATATGAGTTTCGTTTTGTTGTTGACCGCATGTGGAACAAGTAGGTTCAATGTCCTTGATTCTAGAATGAAGAGTAACAGCAGTAGGTAAAGCGT

Reverse complement sequence

ACGCTTTACCTACTGCTGTTACTCTTCATTCTAGAATCAAGGACATTGAACCTACTTGTTCCACATGCGGTCAACAACAAAACGAAACTCATATCTTTTT[G/T]
CACTGTTGCTTTAGTAGACTAGTTTGGTTTATCTTTGATTTTCAACATAAAACGGATGCTCTTAGCTTGATGACATCTATGTATGATATTATTCTTACCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.20%	0.34%	0.00%	NA
All Indica	2759	39.50%	60.20%	0.33%	0.00%	NA
All Japonica	1512	87.90%	11.80%	0.33%	0.00%	NA
Aus	269	72.10%	27.90%	0.00%	0.00%	NA
Indica I	595	45.90%	53.80%	0.34%	0.00%	NA
Indica II	465	16.80%	82.80%	0.43%	0.00%	NA
Indica III	913	42.10%	57.90%	0.00%	0.00%	NA
Indica Intermediate	786	45.00%	54.30%	0.64%	0.00%	NA
Temperate Japonica	767	96.70%	2.70%	0.52%	0.00%	NA
Tropical Japonica	504	76.00%	23.80%	0.20%	0.00%	NA
Japonica Intermediate	241	84.60%	15.40%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	65.60%	32.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717522436	C -> A	LOC_Os07g29810.1	upstream_gene_variant ; 1601.0bp to feature; MODIFIER	silent_mutation	Average:39.303; most accessible tissue: Callus, score: 64.775	N	N	N	N
vg0717522436	C -> A	LOC_Os07g29794.1	downstream_gene_variant ; 1585.0bp to feature; MODIFIER	silent_mutation	Average:39.303; most accessible tissue: Callus, score: 64.775	N	N	N	N
vg0717522436	C -> A	LOC_Os07g29794-LOC_Os07g29810	intergenic_region ; MODIFIER	silent_mutation	Average:39.303; most accessible tissue: Callus, score: 64.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717522436	NA	2.80E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	3.91E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	9.29E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	1.98E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	8.88E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	2.30E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	4.53E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	4.55E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	2.92E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	NA	7.94E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717522436	2.44E-06	2.45E-06	mr1983_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251