\
| Variant ID: vg0717519774 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17519774 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )
CTATTTTTTAATTAAAACTTTTTATTATTGCATATTGTTCTGTTAAAATATATGTGTTGTTAAATAGATCGTTAAAATATCAATGCTTTTCCCTATAAAT[G/A]
TGTTTTATTTCTTTTACTTACTAAATATAGTTACTTTGGGTCTTGAATTATAAATTTTGTGGTAAATAATCTAATGATGAATTATGTATTTTCTATATAA
TTATATAGAAAATACATAATTCATCATTAGATTATTTACCACAAAATTTATAATTCAAGACCCAAAGTAACTATATTTAGTAAGTAAAAGAAATAAAACA[C/T]
ATTTATAGGGAAAAGCATTGATATTTTAACGATCTATTTAACAACACATATATTTTAACAGAACAATATGCAATAATAAAAAGTTTTAATTAAAAAATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 14.50% | 5.25% | 6.01% | NA |
| All Indica | 2759 | 64.00% | 23.90% | 8.52% | 3.55% | NA |
| All Japonica | 1512 | 89.80% | 0.10% | 0.26% | 9.79% | NA |
| Aus | 269 | 82.50% | 4.80% | 1.86% | 10.78% | NA |
| Indica I | 595 | 65.90% | 26.10% | 6.22% | 1.85% | NA |
| Indica II | 465 | 49.70% | 38.70% | 10.32% | 1.29% | NA |
| Indica III | 913 | 66.50% | 19.10% | 7.56% | 6.90% | NA |
| Indica Intermediate | 786 | 68.30% | 19.10% | 10.31% | 2.29% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 77.40% | 0.00% | 0.20% | 22.42% | NA |
| Japonica Intermediate | 241 | 85.10% | 0.40% | 0.41% | 14.11% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 1.04% | 5.21% | NA |
| Intermediate | 90 | 80.00% | 12.20% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717519774 | G -> DEL | N | N | silent_mutation | Average:38.297; most accessible tissue: Callus, score: 54.684 | N | N | N | N |
| vg0717519774 | G -> A | LOC_Os07g29810.1 | upstream_gene_variant ; 4263.0bp to feature; MODIFIER | silent_mutation | Average:38.297; most accessible tissue: Callus, score: 54.684 | N | N | N | N |
| vg0717519774 | G -> A | LOC_Os07g29794.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.297; most accessible tissue: Callus, score: 54.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717519774 | NA | 1.98E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | NA | 4.53E-07 | mr1583 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | NA | 1.29E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | 9.00E-06 | NA | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | 3.06E-06 | 6.52E-11 | mr1221_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | NA | 9.28E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | 4.14E-06 | 7.76E-08 | mr1422_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | NA | 5.79E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | NA | 2.86E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717519774 | NA | 4.49E-08 | mr1850_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |