\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717519774:

Variant ID: vg0717519774 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17519774
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CTATTTTTTAATTAAAACTTTTTATTATTGCATATTGTTCTGTTAAAATATATGTGTTGTTAAATAGATCGTTAAAATATCAATGCTTTTCCCTATAAAT[G/A]
TGTTTTATTTCTTTTACTTACTAAATATAGTTACTTTGGGTCTTGAATTATAAATTTTGTGGTAAATAATCTAATGATGAATTATGTATTTTCTATATAA

Reverse complement sequence

TTATATAGAAAATACATAATTCATCATTAGATTATTTACCACAAAATTTATAATTCAAGACCCAAAGTAACTATATTTAGTAAGTAAAAGAAATAAAACA[C/T]
ATTTATAGGGAAAAGCATTGATATTTTAACGATCTATTTAACAACACATATATTTTAACAGAACAATATGCAATAATAAAAAGTTTTAATTAAAAAATAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 14.50% 5.25% 6.01% NA
All Indica  2759 64.00% 23.90% 8.52% 3.55% NA
All Japonica  1512 89.80% 0.10% 0.26% 9.79% NA
Aus  269 82.50% 4.80% 1.86% 10.78% NA
Indica I  595 65.90% 26.10% 6.22% 1.85% NA
Indica II  465 49.70% 38.70% 10.32% 1.29% NA
Indica III  913 66.50% 19.10% 7.56% 6.90% NA
Indica Intermediate  786 68.30% 19.10% 10.31% 2.29% NA
Temperate Japonica  767 99.50% 0.10% 0.26% 0.13% NA
Tropical Japonica  504 77.40% 0.00% 0.20% 22.42% NA
Japonica Intermediate  241 85.10% 0.40% 0.41% 14.11% NA
VI/Aromatic  96 93.80% 0.00% 1.04% 5.21% NA
Intermediate  90 80.00% 12.20% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717519774 G -> DEL N N silent_mutation Average:38.297; most accessible tissue: Callus, score: 54.684 N N N N
vg0717519774 G -> A LOC_Os07g29810.1 upstream_gene_variant ; 4263.0bp to feature; MODIFIER silent_mutation Average:38.297; most accessible tissue: Callus, score: 54.684 N N N N
vg0717519774 G -> A LOC_Os07g29794.1 intron_variant ; MODIFIER silent_mutation Average:38.297; most accessible tissue: Callus, score: 54.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717519774 NA 1.98E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 NA 4.53E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 NA 1.29E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 9.00E-06 NA mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 3.06E-06 6.52E-11 mr1221_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 NA 9.28E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 4.14E-06 7.76E-08 mr1422_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 NA 5.79E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 NA 2.86E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717519774 NA 4.49E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251