\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717472303:

Variant ID: vg0717472303 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17472303
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCGACCAAGAGGAGGAGAAGGCGGTGGCGGCCAGCGAAGCCTCCGGGGGCCCTCCTTCTCCCCCTCCCCTCTCCTCCCCTTCCCCTCGTCGGCTGCGG[C/A,T]
GGCATGCGAGTGTTGGTATTTCTTAACGATATTACTAGAAATAGTCATTTCAGCAATGGCGCTAGAAATGGTCCTTGTATATTTATGGTCACAGAATTAA

Reverse complement sequence

TTAATTCTGTGACCATAAATATACAAGGACCATTTCTAGCGCCATTGCTGAAATGACTATTTCTAGTAATATCGTTAAGAAATACCAACACTCGCATGCC[G/T,A]
CCGCAGCCGACGAGGGGAAGGGGAGGAGAGGGGAGGGGGAGAAGGAGGGCCCCCGGAGGCTTCGCTGGCCGCCACCGCCTTCTCCTCCTCTTGGTCGCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.60% 0.42% 0.00% T: 0.04%
All Indica  2759 32.80% 66.60% 0.62% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% T: 0.07%
Aus  269 81.80% 17.80% 0.37% 0.00% NA
Indica I  595 8.60% 90.60% 0.84% 0.00% NA
Indica II  465 68.00% 31.60% 0.43% 0.00% NA
Indica III  913 26.70% 72.80% 0.44% 0.00% NA
Indica Intermediate  786 37.30% 62.00% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 2.22% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717472303 C -> A LOC_Os07g29720.1 upstream_gene_variant ; 231.0bp to feature; MODIFIER silent_mutation Average:64.958; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0717472303 C -> A LOC_Os07g29730.1 upstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:64.958; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0717472303 C -> A LOC_Os07g29720-LOC_Os07g29730 intergenic_region ; MODIFIER silent_mutation Average:64.958; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0717472303 C -> T LOC_Os07g29720.1 upstream_gene_variant ; 231.0bp to feature; MODIFIER silent_mutation Average:64.958; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0717472303 C -> T LOC_Os07g29730.1 upstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:64.958; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N
vg0717472303 C -> T LOC_Os07g29720-LOC_Os07g29730 intergenic_region ; MODIFIER silent_mutation Average:64.958; most accessible tissue: Minghui63 flag leaf, score: 77.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717472303 NA 1.25E-18 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717472303 3.50E-06 NA mr1754 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251