\
| Variant ID: vg0717367275 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17367275 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACACCAGCATCATGGAACGGCAGCGCCAACACGCAATGGGATCAACAAGGCCTCATCAACGCCTTCAACACGGTATCACTGTCCCAACCTCCGTCTAGC[G/A]
ACTGGTATATAGACTCGGGTGCTTCTTCTCACATGACGTCCGATGCCGGTACCCTCTCCTTTTCCTCCCAACCTAACCCTAATACACTGTCTCATATTAT
ATAATATGAGACAGTGTATTAGGGTTAGGTTGGGAGGAAAAGGAGAGGGTACCGGCATCGGACGTCATGTGAGAAGAAGCACCCGAGTCTATATACCAGT[C/T]
GCTAGACGGAGGTTGGGACAGTGATACCGTGTTGAAGGCGTTGATGAGGCCTTGTTGATCCCATTGCGTGTTGGCGCTGCCGTTCCATGATGCTGGTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 3.70% | 1.97% | 0.00% | NA |
| All Indica | 2759 | 90.40% | 6.30% | 3.33% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.20% | 20.80% | 11.93% | 0.00% | NA |
| Indica II | 465 | 96.80% | 1.90% | 1.29% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 5.10% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717367275 | G -> A | LOC_Os07g29570.1 | missense_variant ; p.Asp564Asn; MODERATE | nonsynonymous_codon ; D564N | Average:70.497; most accessible tissue: Zhenshan97 young leaf, score: 89.112 | benign |
0.603 |
TOLERATED | 0.44 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717367275 | NA | 3.84E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0717367275 | NA | 1.49E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717367275 | NA | 9.03E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717367275 | 2.14E-06 | NA | mr1378_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717367275 | 2.92E-07 | 2.07E-07 | mr1378_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717367275 | NA | 6.37E-06 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717367275 | NA | 3.35E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717367275 | NA | 2.06E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |