RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0717352217:

Variant ID: vg0717352217 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17352217
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCGGTAATTGGATTATCGCCCTAAGATAACATGTTCTATGCTTTTAGGTTCACAATGTTCACCAAAAAGGCAGGGGGCATGTGTTTACACCCAAATTT[G/A]
GCACCTATGGACGAAATAGGGAAAAACTGCCAAAGTTTGGAAAGTGCCCGGTTTCCTTTACAGGGCCGGTCAGACCGCAGGTATGTGGGCGGTCTGACCG

Reverse complement sequence

CGGTCAGACCGCCCACATACCTGCGGTCTGACCGGCCCTGTAAAGGAAACCGGGCACTTTCCAAACTTTGGCAGTTTTTCCCTATTTCGTCCATAGGTGC[C/T]
AAATTTGGGTGTAAACACATGCCCCCTGCCTTTTTGGTGAACATTGTGAACCTAAAAGCATAGAACATGTTATCTTAGGGCGATAATCCAATTACCGGCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.00%	4.30%	0.68%	0.00%	NA
All Indica	2759	91.50%	7.30%	1.16%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	70.80%	25.50%	3.70%	0.00%	NA
Indica II	465	96.80%	2.40%	0.86%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	94.30%	5.00%	0.76%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717352217	G -> A	LOC_Os07g29550.1	missense_variant ; p.Gly431Ser; MODERATE	nonsynonymous_codon ; G431S	Average:52.493; most accessible tissue: Minghui63 young leaf, score: 71.254	unknown	unknown	TOLERATED	0.12

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717352217	NA	5.58E-11	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0717352217	NA	4.46E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	NA	4.63E-07	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	3.86E-06	9.81E-07	mr1159_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	3.47E-06	5.36E-08	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	NA	2.77E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	NA	1.07E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	4.17E-06	4.17E-06	mr1651_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	3.26E-06	3.26E-06	mr1663_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717352217	NA	4.61E-07	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0717352217:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact