\
| Variant ID: vg0717352217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17352217 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 291. )
GGCCGGTAATTGGATTATCGCCCTAAGATAACATGTTCTATGCTTTTAGGTTCACAATGTTCACCAAAAAGGCAGGGGGCATGTGTTTACACCCAAATTT[G/A]
GCACCTATGGACGAAATAGGGAAAAACTGCCAAAGTTTGGAAAGTGCCCGGTTTCCTTTACAGGGCCGGTCAGACCGCAGGTATGTGGGCGGTCTGACCG
CGGTCAGACCGCCCACATACCTGCGGTCTGACCGGCCCTGTAAAGGAAACCGGGCACTTTCCAAACTTTGGCAGTTTTTCCCTATTTCGTCCATAGGTGC[C/T]
AAATTTGGGTGTAAACACATGCCCCCTGCCTTTTTGGTGAACATTGTGAACCTAAAAGCATAGAACATGTTATCTTAGGGCGATAATCCAATTACCGGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.30% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 91.50% | 7.30% | 1.16% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.80% | 25.50% | 3.70% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 5.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717352217 | G -> A | LOC_Os07g29550.1 | missense_variant ; p.Gly431Ser; MODERATE | nonsynonymous_codon ; G431S | Average:52.493; most accessible tissue: Minghui63 young leaf, score: 71.254 | unknown | unknown | TOLERATED | 0.12 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717352217 | NA | 5.58E-11 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0717352217 | NA | 4.46E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | NA | 4.63E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 3.86E-06 | 9.81E-07 | mr1159_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 3.47E-06 | 5.36E-08 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | NA | 2.77E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | NA | 1.07E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 4.17E-06 | 4.17E-06 | mr1651_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 3.26E-06 | 3.26E-06 | mr1663_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | NA | 4.61E-07 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 2.38E-06 | NA | mr1682_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 3.65E-06 | 8.90E-08 | mr1682_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 8.71E-06 | 8.71E-06 | mr1697_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 4.72E-06 | NA | mr1811_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | NA | 8.29E-09 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | NA | 5.48E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | NA | 3.36E-06 | mr1984_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717352217 | 8.73E-06 | 8.73E-06 | mr1984_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |