\
| Variant ID: vg0717334017 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17334017 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 232. )
GATGGGACTAAATATACACAAATCAGGGTCCACTCTAGTTAGTGGATTCTCTGATGCAGACTGGGCTGGTAGCATAGATGACAGAAGGTCAACTAGTGGA[T/C]
TTGCTATCTTTATTGGTTCTAATCTAGTGTCATGGAATGCTAGAAAACAGGCCACAGTATCAAGATCTATTACAGAGTCAGAATACAAAGCAATAGCCAA
TTGGCTATTGCTTTGTATTCTGACTCTGTAATAGATCTTGATACTGTGGCCTGTTTTCTAGCATTCCATGACACTAGATTAGAACCAATAAAGATAGCAA[A/G]
TCCACTAGTTGACCTTCTGTCATCTATGCTACCAGCCCAGTCTGCATCAGAGAATCCACTAACTAGAGTGGACCCTGATTTGTGTATATTTAGTCCCATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 38.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 36.60% | 63.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.80% | 7.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 43.70% | 56.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 16.30% | 83.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 39.10% | 60.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717334017 | T -> C | LOC_Os07g29520.1 | missense_variant ; p.Phe814Leu; MODERATE | nonsynonymous_codon ; F814L | Average:41.489; most accessible tissue: Zhenshan97 young leaf, score: 49.329 | benign |
1.429 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717334017 | 4.14E-06 | 1.20E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | NA | 5.09E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 1.88E-07 | 5.02E-08 | mr1107 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | NA | 2.34E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 3.52E-06 | 2.38E-06 | mr1241 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 2.01E-06 | NA | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 7.78E-06 | 5.17E-07 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 9.29E-06 | NA | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | NA | 1.99E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | NA | 1.38E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | NA | 4.40E-07 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 2.84E-06 | NA | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 3.02E-06 | 2.77E-06 | mr1878 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | 3.60E-06 | NA | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | NA | 4.10E-07 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717334017 | NA | 8.33E-08 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |