\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717328894:

Variant ID: vg0717328894 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17328894
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTCAACCTATAGCACATCGCACGAGGAATTGTGGGCCTTCACCAATATTTTCTTGATCTCGTATGCCCGCAGCCCCTCACCTTCCTCCCCATGTTTTG[T/C]
TGGAAACATATCAAGTTACTGTGCACCACATAGTGCCACAAAGATGGCACCTATTGCTGATCAAATAAACTGATGCATCCATACAAGTATTAAATGTTTG

Reverse complement sequence

CAAACATTTAATACTTGTATGGATGCATCAGTTTATTTGATCAGCAATAGGTGCCATCTTTGTGGCACTATGTGGTGCACAGTAACTTGATATGTTTCCA[A/G]
CAAAACATGGGGAGGAAGGTGAGGGGCTGCGGGCATACGAGATCAAGAAAATATTGGTGAAGGCCCACAATTCCTCGTGCGATGTGCTATAGGTTGACCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 38.00% 0.06% 0.00% NA
All Indica  2759 36.70% 63.20% 0.11% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 44.00% 56.00% 0.00% 0.00% NA
Indica II  465 16.30% 83.70% 0.00% 0.00% NA
Indica III  913 40.00% 59.80% 0.22% 0.00% NA
Indica Intermediate  786 39.30% 60.60% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717328894 T -> C LOC_Os07g29520.1 upstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:81.62; most accessible tissue: Minghui63 root, score: 96.187 N N N N
vg0717328894 T -> C LOC_Os07g29510.1 downstream_gene_variant ; 3737.0bp to feature; MODIFIER silent_mutation Average:81.62; most accessible tissue: Minghui63 root, score: 96.187 N N N N
vg0717328894 T -> C LOC_Os07g29510-LOC_Os07g29520 intergenic_region ; MODIFIER silent_mutation Average:81.62; most accessible tissue: Minghui63 root, score: 96.187 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0717328894 T C 0.0 -0.01 0.0 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717328894 NA 4.63E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 5.06E-07 1.41E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 NA 5.55E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 3.37E-06 2.61E-06 mr1241 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 7.00E-06 NA mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 NA 1.55E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 NA 9.54E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 NA 1.31E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 NA 1.53E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 9.42E-06 NA mr1878 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 9.82E-06 6.18E-06 mr1878 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 2.68E-06 NA mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 NA 3.42E-07 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717328894 NA 1.42E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251