\
| Variant ID: vg0717319936 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17319936 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAATTGCAAATAGGAGTTAAATACGAATGATAAATTGGGGTTTCGAAGAACAAGCAGACGGACGGTCTAGCCGACACGCGCACTGCAAGCAAGTAGCAAT[A/G,T]
GCTAAACTTTAATCTATCAAAACCCAAGAAACTGTAAAGGGGTACCTAACTATTTAAGGAGGTGGGAGGACGATCTAAGGGTACCCTAGGGTCGTGCTCC
GGAGCACGACCCTAGGGTACCCTTAGATCGTCCTCCCACCTCCTTAAATAGTTAGGTACCCCTTTACAGTTTCTTGGGTTTTGATAGATTAAAGTTTAGC[T/C,A]
ATTGCTACTTGCTTGCAGTGCGCGTGTCGGCTAGACCGTCCGTCTGCTTGTTCTTCGAAACCCCAATTTATCATTCGTATTTAACTCCTATTTGCAATTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.20% | 0.30% | 31.38% | 24.02% | T: 0.02% |
| All Indica | 2759 | 9.00% | 0.00% | 51.32% | 39.62% | T: 0.04% |
| All Japonica | 1512 | 97.60% | 1.00% | 0.46% | 0.99% | NA |
| Aus | 269 | 78.10% | 0.40% | 17.10% | 4.46% | NA |
| Indica I | 595 | 7.20% | 0.00% | 23.53% | 69.24% | NA |
| Indica II | 465 | 8.00% | 0.00% | 58.06% | 33.98% | NA |
| Indica III | 913 | 7.40% | 0.00% | 66.92% | 25.52% | T: 0.11% |
| Indica Intermediate | 786 | 12.80% | 0.00% | 50.25% | 36.90% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 95.40% | 3.00% | 0.99% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 15.56% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717319936 | A -> DEL | N | N | silent_mutation | Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0717319936 | A -> G | LOC_Os07g29510.1 | upstream_gene_variant ; 4396.0bp to feature; MODIFIER | silent_mutation | Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0717319936 | A -> G | LOC_Os07g29490.1 | downstream_gene_variant ; 3372.0bp to feature; MODIFIER | silent_mutation | Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0717319936 | A -> G | LOC_Os07g29500.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0717319936 | A -> T | LOC_Os07g29510.1 | upstream_gene_variant ; 4396.0bp to feature; MODIFIER | silent_mutation | Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0717319936 | A -> T | LOC_Os07g29490.1 | downstream_gene_variant ; 3372.0bp to feature; MODIFIER | silent_mutation | Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0717319936 | A -> T | LOC_Os07g29500.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717319936 | NA | 9.14E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717319936 | NA | 9.93E-09 | mr1595 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717319936 | NA | 6.33E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717319936 | NA | 1.94E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |