\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717319936:

Variant ID: vg0717319936 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17319936
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATTGCAAATAGGAGTTAAATACGAATGATAAATTGGGGTTTCGAAGAACAAGCAGACGGACGGTCTAGCCGACACGCGCACTGCAAGCAAGTAGCAAT[A/G,T]
GCTAAACTTTAATCTATCAAAACCCAAGAAACTGTAAAGGGGTACCTAACTATTTAAGGAGGTGGGAGGACGATCTAAGGGTACCCTAGGGTCGTGCTCC

Reverse complement sequence

GGAGCACGACCCTAGGGTACCCTTAGATCGTCCTCCCACCTCCTTAAATAGTTAGGTACCCCTTTACAGTTTCTTGGGTTTTGATAGATTAAAGTTTAGC[T/C,A]
ATTGCTACTTGCTTGCAGTGCGCGTGTCGGCTAGACCGTCCGTCTGCTTGTTCTTCGAAACCCCAATTTATCATTCGTATTTAACTCCTATTTGCAATTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.20% 0.30% 31.38% 24.02% T: 0.02%
All Indica  2759 9.00% 0.00% 51.32% 39.62% T: 0.04%
All Japonica  1512 97.60% 1.00% 0.46% 0.99% NA
Aus  269 78.10% 0.40% 17.10% 4.46% NA
Indica I  595 7.20% 0.00% 23.53% 69.24% NA
Indica II  465 8.00% 0.00% 58.06% 33.98% NA
Indica III  913 7.40% 0.00% 66.92% 25.52% T: 0.11%
Indica Intermediate  786 12.80% 0.00% 50.25% 36.90% NA
Temperate Japonica  767 99.10% 0.00% 0.26% 0.65% NA
Tropical Japonica  504 95.40% 3.00% 0.99% 0.60% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 68.90% 0.00% 15.56% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717319936 A -> DEL N N silent_mutation Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0717319936 A -> G LOC_Os07g29510.1 upstream_gene_variant ; 4396.0bp to feature; MODIFIER silent_mutation Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0717319936 A -> G LOC_Os07g29490.1 downstream_gene_variant ; 3372.0bp to feature; MODIFIER silent_mutation Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0717319936 A -> G LOC_Os07g29500.1 intron_variant ; MODIFIER silent_mutation Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0717319936 A -> T LOC_Os07g29510.1 upstream_gene_variant ; 4396.0bp to feature; MODIFIER silent_mutation Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0717319936 A -> T LOC_Os07g29490.1 downstream_gene_variant ; 3372.0bp to feature; MODIFIER silent_mutation Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg0717319936 A -> T LOC_Os07g29500.1 intron_variant ; MODIFIER silent_mutation Average:11.554; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717319936 NA 9.14E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717319936 NA 9.93E-09 mr1595 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717319936 NA 6.33E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717319936 NA 1.94E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251