\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717315974:

Variant ID: vg0717315974 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17315974
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAAGCTGTTGATCAAAAGGAGTATAGAAGTATGATTGGATCTTTGTTGTATCTAACTTCTTCTAGGCCAAACATACAATTTGTTGTGTGTTTGTGTGC[G/A]
CGCTTTCAAGCTTCTCCTCGTGCTTCACATCGTCAAGCGGTCAAGCGAATAATGAGGTATTTAAATCATACCCTTGAGTTTGGAATTTGGTATTCTACTT

Reverse complement sequence

AAGTAGAATACCAAATTCCAAACTCAAGGGTATGATTTAAATACCTCATTATTCGCTTGACCGCTTGACGATGTGAAGCACGAGGAGAAGCTTGAAAGCG[C/T]
GCACACAAACACACAACAAATTGTATGTTTGGCCTAGAAGAAGTTAGATACAACAAAGATCCAATCATACTTCTATACTCCTTTTGATCAACAGCTTCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 37.80% 0.78% 0.02% NA
All Indica  2759 37.00% 62.70% 0.29% 0.00% NA
All Japonica  1512 97.40% 0.70% 1.85% 0.07% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 45.00% 54.80% 0.17% 0.00% NA
Indica II  465 16.30% 83.40% 0.22% 0.00% NA
Indica III  913 39.60% 60.00% 0.33% 0.00% NA
Indica Intermediate  786 39.90% 59.70% 0.38% 0.00% NA
Temperate Japonica  767 99.00% 0.90% 0.13% 0.00% NA
Tropical Japonica  504 96.40% 0.20% 3.17% 0.20% NA
Japonica Intermediate  241 94.60% 0.80% 4.56% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717315974 G -> DEL LOC_Os07g29490.1 N frameshift_variant Average:16.369; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 N N N N
vg0717315974 G -> A LOC_Os07g29490.1 synonymous_variant ; p.Ala143Ala; LOW synonymous_codon Average:16.369; most accessible tissue: Zhenshan97 flag leaf, score: 23.298 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717315974 NA 5.20E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974 1.34E-06 2.15E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974 NA 5.20E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974 NA 2.42E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974 1.58E-06 2.92E-06 mr1878 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974 NA 1.01E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717315974 NA 8.03E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251