\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717272423:

Variant ID: vg0717272423 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17272423
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTTAGTAATCAGGTCTACAGTGGCAAAGAAGCATACTATGATATTAATCAACATCTATTTCATTCAAACAAAAGGATATATGAGAAAGTAAACTAGTC[C/T]
ATTGTTTCGAACAGCATGACCTCAGGATAAAATAGTGCAACAGATACAGAGTTAAACATCATATACAAATTTCGTAGCTTATTCTTAGAAGACATAAGAC

Reverse complement sequence

GTCTTATGTCTTCTAAGAATAAGCTACGAAATTTGTATATGATGTTTAACTCTGTATCTGTTGCACTATTTTATCCTGAGGTCATGCTGTTCGAAACAAT[G/A]
GACTAGTTTACTTTCTCATATATCCTTTTGTTTGAATGAAATAGATGTTGATTAATATCATAGTATGCTTCTTTGCCACTGTAGACCTGATTACTAACCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 47.20% 0.40% 0.00% NA
All Indica  2759 20.40% 79.10% 0.54% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 38.70% 60.50% 0.84% 0.00% NA
Indica II  465 6.50% 92.90% 0.65% 0.00% NA
Indica III  913 17.60% 82.10% 0.22% 0.00% NA
Indica Intermediate  786 18.10% 81.30% 0.64% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 58.90% 36.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717272423 C -> T LOC_Os07g29430.1 upstream_gene_variant ; 2449.0bp to feature; MODIFIER silent_mutation Average:54.904; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0717272423 C -> T LOC_Os07g29410.1 downstream_gene_variant ; 2310.0bp to feature; MODIFIER silent_mutation Average:54.904; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0717272423 C -> T LOC_Os07g29440.1 downstream_gene_variant ; 3767.0bp to feature; MODIFIER silent_mutation Average:54.904; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0717272423 C -> T LOC_Os07g29410.2 downstream_gene_variant ; 2310.0bp to feature; MODIFIER silent_mutation Average:54.904; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0717272423 C -> T LOC_Os07g29420.1 intron_variant ; MODIFIER silent_mutation Average:54.904; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0717272423 C -> T LOC_Os07g29420.3 intron_variant ; MODIFIER silent_mutation Average:54.904; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N
vg0717272423 C -> T LOC_Os07g29420.4 intron_variant ; MODIFIER silent_mutation Average:54.904; most accessible tissue: Minghui63 flag leaf, score: 86.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717272423 NA 3.59E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 5.20E-22 mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 3.76E-06 6.71E-39 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 1.31E-06 9.95E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 4.81E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 6.43E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 7.90E-06 NA mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 2.72E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 3.33E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 3.49E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 2.61E-28 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 2.76E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 7.17E-11 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 3.39E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 2.69E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 1.70E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 1.06E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 1.28E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 2.70E-68 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 4.82E-08 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 1.08E-06 NA mr1973 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 1.79E-06 4.37E-09 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 7.36E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 2.95E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 4.61E-14 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 7.67E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 1.69E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 1.52E-62 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 2.52E-08 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717272423 NA 6.29E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251