Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717192832:

Variant ID: vg0717192832 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17192832
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GATCATCAGAAATAGAACAAATTCCATGCGAATACTAGACTATTGACGGTGTGCAGATGTATCAGCATTGAGTTACCTTCAGATATCAGTGAAATACATA[A/G]
TAGACAATCAAACCAAACAGAATGATCGAGACCAAGGCACAGAACTTTGAACCATATAGTATAATAACGCAATGTGGAACGAAAATATATGCGAGAACCA

Reverse complement sequence

TGGTTCTCGCATATATTTTCGTTCCACATTGCGTTATTATACTATATGGTTCAAAGTTCTGTGCCTTGGTCTCGATCATTCTGTTTGGTTTGATTGTCTA[T/C]
TATGTATTTCACTGATATCTGAAGGTAACTCAATGCTGATACATCTGCACACCGTCAATAGTCTAGTATTCGCATGGAATTTGTTCTATTTCTGATGATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	22.80%	2.33%	0.00%	NA
All Indica	2759	98.30%	1.30%	0.36%	0.00%	NA
All Japonica	1512	33.90%	60.10%	6.08%	0.00%	NA
Aus	269	93.30%	5.90%	0.74%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	96.80%	3.00%	0.22%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	1.90%	1.02%	0.00%	NA
Temperate Japonica	767	33.00%	59.20%	7.82%	0.00%	NA
Tropical Japonica	504	27.60%	69.20%	3.17%	0.00%	NA
Japonica Intermediate	241	49.80%	43.60%	6.64%	0.00%	NA
VI/Aromatic	96	9.40%	88.50%	2.08%	0.00%	NA
Intermediate	90	61.10%	34.40%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717192832	A -> G	LOC_Os07g29320.1	downstream_gene_variant ; 2377.0bp to feature; MODIFIER	silent_mutation	Average:51.945; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0717192832	A -> G	LOC_Os07g29310-LOC_Os07g29320	intergenic_region ; MODIFIER	silent_mutation	Average:51.945; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717192832	NA	3.90E-07	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	3.69E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	8.66E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	7.54E-06	NA	mr1591_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	3.60E-06	NA	mr1594_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	1.37E-07	mr1594_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	4.18E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	9.67E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	3.27E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	3.93E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	3.46E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717192832	NA	2.20E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251