RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0717125075:

Variant ID: vg0717125075 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17125075
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCACAGGAGATGGGTTCACAGCCTAATCCAGTGAACACAGCCTAGTGAGGATGAACTATATAGATACATAGCATATTATAAAATAATGAAGATATAT[A/G]
TTGAATATTATGTGAATTATGTGGGATGATGATTTAACATGCTTGCATTTAAAAGCTCTCTAAATTTAATAAATTATAAAATTATAGGTAATATAGCATG

Reverse complement sequence

CATGCTATATTACCTATAATTTTATAATTTATTAAATTTAGAGAGCTTTTAAATGCAAGCATGTTAAATCATCATCCCACATAATTCACATAATATTCAA[T/C]
ATATATCTTCATTATTTTATAATATGCTATGTATCTATATAGTTCATCCTCACTAGGCTGTGTTCACTGGATTAGGCTGTGAACCCATCTCCTGTGCACA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	45.30%	0.02%	0.57%	NA
All Indica	2759	25.90%	74.10%	0.00%	0.00%	NA
All Japonica	1512	97.60%	0.70%	0.00%	1.79%	NA
Aus	269	78.80%	21.20%	0.00%	0.00%	NA
Indica I	595	46.40%	53.60%	0.00%	0.00%	NA
Indica II	465	6.00%	94.00%	0.00%	0.00%	NA
Indica III	913	19.50%	80.50%	0.00%	0.00%	NA
Indica Intermediate	786	29.60%	70.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.10%	0.80%	0.00%	0.13%	NA
Tropical Japonica	504	96.20%	0.40%	0.00%	3.37%	NA
Japonica Intermediate	241	95.40%	0.80%	0.00%	3.73%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	66.70%	32.20%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717125075	A -> DEL	N	N	silent_mutation	Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0717125075	A -> G	LOC_Os07g29224.1	upstream_gene_variant ; 1127.0bp to feature; MODIFIER	silent_mutation	Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0717125075	A -> G	LOC_Os07g29220.1	downstream_gene_variant ; 4650.0bp to feature; MODIFIER	silent_mutation	Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0717125075	A -> G	LOC_Os07g29220-LOC_Os07g29224	intergenic_region ; MODIFIER	silent_mutation	Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717125075	NA	2.45E-06	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	NA	1.24E-07	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	NA	1.03E-08	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	NA	2.07E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	NA	2.04E-06	mr1186_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	NA	7.08E-07	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	5.58E-07	5.53E-07	mr1245_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	2.57E-06	8.64E-08	mr1245_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	4.86E-06	1.78E-09	mr1278_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717125075	NA	3.49E-07	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 38 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg0717125075:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact