\
| Variant ID: vg0717125075 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17125075 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 117. )
TGTGCACAGGAGATGGGTTCACAGCCTAATCCAGTGAACACAGCCTAGTGAGGATGAACTATATAGATACATAGCATATTATAAAATAATGAAGATATAT[A/G]
TTGAATATTATGTGAATTATGTGGGATGATGATTTAACATGCTTGCATTTAAAAGCTCTCTAAATTTAATAAATTATAAAATTATAGGTAATATAGCATG
CATGCTATATTACCTATAATTTTATAATTTATTAAATTTAGAGAGCTTTTAAATGCAAGCATGTTAAATCATCATCCCACATAATTCACATAATATTCAA[T/C]
ATATATCTTCATTATTTTATAATATGCTATGTATCTATATAGTTCATCCTCACTAGGCTGTGTTCACTGGATTAGGCTGTGAACCCATCTCCTGTGCACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.10% | 45.30% | 0.02% | 0.57% | NA |
| All Indica | 2759 | 25.90% | 74.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.60% | 0.70% | 0.00% | 1.79% | NA |
| Aus | 269 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.40% | 53.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 19.50% | 80.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 29.60% | 70.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 96.20% | 0.40% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.80% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 32.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717125075 | A -> DEL | N | N | silent_mutation | Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0717125075 | A -> G | LOC_Os07g29224.1 | upstream_gene_variant ; 1127.0bp to feature; MODIFIER | silent_mutation | Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0717125075 | A -> G | LOC_Os07g29220.1 | downstream_gene_variant ; 4650.0bp to feature; MODIFIER | silent_mutation | Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg0717125075 | A -> G | LOC_Os07g29220-LOC_Os07g29224 | intergenic_region ; MODIFIER | silent_mutation | Average:65.653; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717125075 | NA | 2.45E-06 | mr1156_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 1.24E-07 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 1.03E-08 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 2.07E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 2.04E-06 | mr1186_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 7.08E-07 | mr1186_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 5.58E-07 | 5.53E-07 | mr1245_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 2.57E-06 | 8.64E-08 | mr1245_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 4.86E-06 | 1.78E-09 | mr1278_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 3.49E-07 | mr1278_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 6.03E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 3.68E-08 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 8.03E-06 | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 5.95E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 2.68E-07 | 2.94E-08 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 5.37E-06 | 8.11E-08 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 3.78E-06 | mr1374_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 1.94E-06 | mr1445_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 1.25E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 5.54E-07 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 8.26E-08 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 2.49E-06 | mr1616_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 9.71E-06 | mr1616_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 5.48E-06 | NA | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 3.28E-07 | 3.47E-12 | mr1648_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 5.00E-07 | 5.00E-07 | mr1652_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 8.74E-07 | mr1655_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 1.50E-08 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 1.30E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 2.85E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 4.44E-06 | 4.44E-06 | mr1688_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 8.64E-10 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | 2.35E-07 | 2.35E-07 | mr1697_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 2.34E-06 | mr1706_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 4.78E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 1.53E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 5.87E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717125075 | NA | 9.05E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |