\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717124098:

Variant ID: vg0717124098 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 17124098
Reference Allele: GGGGGGGGAAlternative Allele: AGGGGGGGA,G,GAGGGGGGGA
Primary Allele: AGGGGGGGASecondary Allele: GGGGGGGGA

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, GGGGGGGGA: 0.21, GGGAGGGGGGGA: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAGTCTAAAACATCTTAGCTCTCTTGTTTTCATTCGTGCGATATATCGCCTCGTCACCGTGCACCCGCTTCCTAGCCGAATCTTCAAGGAGGGGGGG[GGGGGGGGA/AGGGGGGGA,G,GAGGGGGGGA]
AGGGGAGGGGTCCCTCACTTCCCCGTTGTAGGAGTGCTCCAACACATCAAGAGCTATATTTTTCAGACAAATATTTTCTTAATCCGAGTTTGTATAAAAA

Reverse complement sequence

TTTTTATACAAACTCGGATTAAGAAAATATTTGTCTGAAAAATATAGCTCTTGATGTGTTGGAGCACTCCTACAACGGGGAAGTGAGGGACCCCTCCCCT[TCCCCCCCC/TCCCCCCCT,C,TCCCCCCCTC]
CCCCCCCTCCTTGAAGATTCGGCTAGGAAGCGGGTGCACGGTGACGAGGCGATATATCGCACGAATGAAAACAAGAGAGCTAAGATGTTTTAGACTTGTT

Allele Frequencies:

Populations Population SizeFrequency of AGGGGGGGA(primary allele) Frequency of GGGGGGGGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 46.00% 4.51% 0.59% G: 0.72%; GAGGGGGGGA: 0.11%
All Indica  2759 79.00% 12.70% 6.96% 0.00% G: 1.20%; GAGGGGGGGA: 0.18%
All Japonica  1512 0.70% 97.30% 0.20% 1.79% G: 0.07%
Aus  269 20.40% 76.60% 2.97% 0.00% NA
Indica I  595 74.10% 8.90% 16.81% 0.00% G: 0.17%
Indica II  465 89.90% 7.50% 2.58% 0.00% NA
Indica III  913 80.60% 15.00% 3.72% 0.00% GAGGGGGGGA: 0.44%; G: 0.22%
Indica Intermediate  786 74.30% 15.90% 5.85% 0.00% G: 3.82%; GAGGGGGGGA: 0.13%
Temperate Japonica  767 0.70% 98.80% 0.26% 0.13% G: 0.13%
Tropical Japonica  504 0.40% 96.00% 0.20% 3.37% NA
Japonica Intermediate  241 1.20% 95.00% 0.00% 3.73% NA
VI/Aromatic  96 1.00% 96.90% 2.08% 0.00% NA
Intermediate  90 31.10% 58.90% 8.89% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717124098 GGGGGGGGA -> AGGGGGGGA LOC_Os07g29224.1 upstream_gene_variant ; 2104.0bp to feature; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> AGGGGGGGA LOC_Os07g29220.1 downstream_gene_variant ; 3673.0bp to feature; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> AGGGGGGGA LOC_Os07g29220-LOC_Os07g29224 intergenic_region ; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> GAGGGGGGGA LOC_Os07g29224.1 upstream_gene_variant ; 2103.0bp to feature; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> GAGGGGGGGA LOC_Os07g29220.1 downstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> GAGGGGGGGA LOC_Os07g29220-LOC_Os07g29224 intergenic_region ; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> G LOC_Os07g29224.1 upstream_gene_variant ; 2103.0bp to feature; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> G LOC_Os07g29220.1 downstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> G LOC_Os07g29220-LOC_Os07g29224 intergenic_region ; MODIFIER silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg0717124098 GGGGGGGGA -> DEL N N silent_mutation Average:65.851; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717124098 NA 2.05E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.97E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 3.69E-57 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 7.56E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.90E-27 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 2.44E-42 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.55E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 2.34E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.42E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 7.16E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 3.37E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 6.60E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.65E-59 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 3.72E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.68E-32 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.49E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 6.21E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.68E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.58E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 3.76E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.34E-59 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 9.63E-72 mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 4.61E-40 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.89E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.72E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 5.98E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 1.56E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 6.12E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 7.08E-57 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 1.10E-06 NA mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 1.83E-08 1.60E-08 mr1528_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 6.70E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 3.96E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 3.51E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 7.87E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717124098 NA 2.08E-33 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251