\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717086462:

Variant ID: vg0717086462 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17086462
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAGATGATCGGAGCGAGGATCAGGGACACGAACTTCTTGCAAGGAGATGACATTCTCTGGATCAATTTTAAGGGAATCTACGAACTATACCAGCTGGA[T/C]
GCCCTCGATGTCTCTATTATGAGTTGCTGGATTTTGTAAGTATATCGTTCAGTTAGATTTCTTACTACGTCTCCTTTAATTAATTAGGTCCTTGTATATA

Reverse complement sequence

TATATACAAGGACCTAATTAATTAAAGGAGACGTAGTAAGAAATCTAACTGAACGATATACTTACAAAATCCAGCAACTCATAATAGAGACATCGAGGGC[A/G]
TCCAGCTGGTATAGTTCGTAGATTCCCTTAAAATTGATCCAGAGAATGTCATCTCCTTGCAAGAAGTTCGTGTCCCTGATCCTCGCTCCGATCATCTCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.30% 3.20% 28.71% 33.79% NA
All Indica  2759 5.30% 0.50% 40.27% 53.93% NA
All Japonica  1512 86.60% 8.00% 4.96% 0.46% NA
Aus  269 9.30% 4.50% 56.13% 30.11% NA
Indica I  595 5.40% 0.00% 39.33% 55.29% NA
Indica II  465 4.30% 0.60% 14.41% 80.65% NA
Indica III  913 2.30% 0.20% 53.12% 44.36% NA
Indica Intermediate  786 9.20% 1.30% 41.35% 48.22% NA
Temperate Japonica  767 79.50% 13.80% 6.00% 0.65% NA
Tropical Japonica  504 94.40% 1.60% 3.97% 0.00% NA
Japonica Intermediate  241 92.50% 2.90% 3.73% 0.83% NA
VI/Aromatic  96 95.80% 1.00% 2.08% 1.04% NA
Intermediate  90 53.30% 4.40% 20.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717086462 T -> DEL LOC_Os07g29180.1 N frameshift_variant Average:7.447; most accessible tissue: Minghui63 root, score: 10.708 N N N N
vg0717086462 T -> C LOC_Os07g29180.1 synonymous_variant ; p.Asp907Asp; LOW synonymous_codon Average:7.447; most accessible tissue: Minghui63 root, score: 10.708 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717086462 NA 1.59E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 6.81E-06 mr1159_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 2.85E-08 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 3.00E-06 NA mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 1.12E-07 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 1.13E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 7.31E-14 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 1.66E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 1.25E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 5.41E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 7.33E-06 7.33E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 1.70E-06 1.70E-06 mr1514_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 2.00E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 6.43E-06 NA mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 4.35E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 4.08E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 1.21E-06 3.04E-12 mr1690_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 9.96E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717086462 NA 4.05E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251