\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717072590:

Variant ID: vg0717072590 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17072590
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.15, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGATATATGATAACTCGATGAATTACATAAACAAGATTAGAGTATCATAAAGATGGAAGCACTAATCCCGAGAACGCAAGCCGCCATAACAAGTTTTA[C/T]
CTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCCGAATGCAAGAACTCATCGAAACAAAACGAAAGTAAAAGGGTAGCGATGCGCCGAGATTGTATTG

Reverse complement sequence

CAATACAATCTCGGCGCATCGCTACCCTTTTACTTTCGTTTTGTTTCGATGAGTTCTTGCATTCGGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAG[G/A]
TAAAACTTGTTATGGCGGCTTGCGTTCTCGGGATTAGTGCTTCCATCTTTATGATACTCTAATCTTGTTTATGTAATTCATCGAGTTATCATATATCTTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 38.30% 0.99% 3.41% NA
All Indica  2759 88.40% 4.80% 1.20% 5.62% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 81.40% 12.30% 4.83% 1.49% NA
Indica I  595 95.50% 1.50% 0.67% 2.35% NA
Indica II  465 91.80% 3.40% 0.00% 4.73% NA
Indica III  913 87.00% 2.30% 1.64% 9.09% NA
Indica Intermediate  786 82.60% 11.10% 1.78% 4.58% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 38.90% 57.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717072590 C -> DEL N N silent_mutation Average:27.545; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0717072590 C -> T LOC_Os07g29150.1 upstream_gene_variant ; 4545.0bp to feature; MODIFIER silent_mutation Average:27.545; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0717072590 C -> T LOC_Os07g29170.1 upstream_gene_variant ; 2249.0bp to feature; MODIFIER silent_mutation Average:27.545; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0717072590 C -> T LOC_Os07g29160.1 downstream_gene_variant ; 987.0bp to feature; MODIFIER silent_mutation Average:27.545; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0717072590 C -> T LOC_Os07g29160-LOC_Os07g29170 intergenic_region ; MODIFIER silent_mutation Average:27.545; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717072590 NA 3.80E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 3.40E-07 NA mr1454 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 1.29E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 7.54E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 1.39E-11 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 8.78E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 4.44E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 7.10E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 3.47E-07 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 5.37E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 3.25E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 3.88E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 2.91E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 9.29E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 3.42E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717072590 NA 5.82E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251