Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717069846:

Variant ID: vg0717069846 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17069846
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTATCCCACTGTTCACTATTTTGGTGGGAGGTTAAAGGGGGCGAATTTTTGTAATTTTTTTCCAAACAAGAACAGGGAAATTATAAAAGTATGTAAC[A/G]
GGGTACTAATCATTTCCTATTAATTTAGTAGTACTTATGTTATTAGATGTTAAGTAATATTTTGTTCATTTTTCAGCAATGGATCGAAGTTGGATGTATA

Reverse complement sequence

TATACATCCAACTTCGATCCATTGCTGAAAAATGAACAAAATATTACTTAACATCTAATAACATAAGTACTACTAAATTAATAGGAAATGATTAGTACCC[T/C]
GTTACATACTTTTATAATTTCCCTGTTCTTGTTTGGAAAAAAATTACAAAAATTCGCCCCCTTTAACCTCCCACCAAAATAGTGAACAGTGGGATAATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.50%	0.15%	0.11%	NA
All Indica	2759	96.50%	3.20%	0.25%	0.11%	NA
All Japonica	1512	6.20%	93.80%	0.00%	0.00%	NA
Aus	269	88.50%	11.50%	0.00%	0.00%	NA
Indica I	595	98.50%	1.20%	0.17%	0.17%	NA
Indica II	465	96.60%	2.80%	0.43%	0.22%	NA
Indica III	913	98.20%	1.50%	0.11%	0.11%	NA
Indica Intermediate	786	92.90%	6.70%	0.38%	0.00%	NA
Temperate Japonica	767	8.00%	92.00%	0.00%	0.00%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	46.70%	51.10%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717069846	A -> DEL	N	N	silent_mutation	Average:56.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0717069846	A -> G	LOC_Os07g29140.1	upstream_gene_variant ; 3683.0bp to feature; MODIFIER	silent_mutation	Average:56.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0717069846	A -> G	LOC_Os07g29150.1	upstream_gene_variant ; 1801.0bp to feature; MODIFIER	silent_mutation	Average:56.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0717069846	A -> G	LOC_Os07g29160.1	upstream_gene_variant ; 433.0bp to feature; MODIFIER	silent_mutation	Average:56.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0717069846	A -> G	LOC_Os07g29170.1	upstream_gene_variant ; 4993.0bp to feature; MODIFIER	silent_mutation	Average:56.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0717069846	A -> G	LOC_Os07g29150-LOC_Os07g29160	intergenic_region ; MODIFIER	silent_mutation	Average:56.263; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717069846	9.42E-07	9.42E-07	mr1392	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251