\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717056890:

Variant ID: vg0717056890 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17056890
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CACACATTTATCTGCCTCATTGACTGCAAAGCCTGCAGATGTCAATGTTTTGTCAAATTTCTCATGACATTGCTTAGGAGCTTGTTTTAGACCATACAAA[G/T]
ACTTCAATAATTTGCACACTTTGCCTTCTTGACCTTCAACTACAAACCCATCAGGTTGATCCATATAGATCTCCTCATCCAGCTCTCCATTAAGAAAAGC

Reverse complement sequence

GCTTTTCTTAATGGAGAGCTGGATGAGGAGATCTATATGGATCAACCTGATGGGTTTGTAGTTGAAGGTCAAGAAGGCAAAGTGTGCAAATTATTGAAGT[C/A]
TTTGTATGGTCTAAAACAAGCTCCTAAGCAATGTCATGAGAAATTTGACAAAACATTGACATCTGCAGGCTTTGCAGTCAATGAGGCAGATAAATGTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 21.50% 1.02% 38.95% NA
All Indica  2759 6.10% 28.30% 0.76% 64.81% NA
All Japonica  1512 97.40% 0.60% 1.46% 0.53% NA
Aus  269 12.30% 78.40% 1.49% 7.81% NA
Indica I  595 3.90% 37.60% 0.84% 57.65% NA
Indica II  465 4.30% 6.50% 0.22% 89.03% NA
Indica III  913 3.00% 31.00% 0.66% 65.39% NA
Indica Intermediate  786 12.50% 31.20% 1.15% 55.22% NA
Temperate Japonica  767 99.10% 0.00% 0.13% 0.78% NA
Tropical Japonica  504 96.00% 1.40% 2.58% 0.00% NA
Japonica Intermediate  241 95.00% 0.80% 3.32% 0.83% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 57.80% 15.60% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717056890 G -> DEL N N silent_mutation Average:13.913; most accessible tissue: Minghui63 flower, score: 16.541 N N N N
vg0717056890 G -> T LOC_Os07g29110.1 downstream_gene_variant ; 3195.0bp to feature; MODIFIER silent_mutation Average:13.913; most accessible tissue: Minghui63 flower, score: 16.541 N N N N
vg0717056890 G -> T LOC_Os07g29110-LOC_Os07g29140 intergenic_region ; MODIFIER silent_mutation Average:13.913; most accessible tissue: Minghui63 flower, score: 16.541 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717056890 NA 1.38E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 1.94E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 3.72E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 8.94E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 1.61E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 5.63E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 4.35E-07 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 9.09E-06 NA mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 5.76E-07 1.34E-08 mr1528_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 2.33E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 4.16E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717056890 NA 3.01E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251