\
| Variant ID: vg0717056890 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 17056890 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.07, others allele: 0.00, population size: 90. )
CACACATTTATCTGCCTCATTGACTGCAAAGCCTGCAGATGTCAATGTTTTGTCAAATTTCTCATGACATTGCTTAGGAGCTTGTTTTAGACCATACAAA[G/T]
ACTTCAATAATTTGCACACTTTGCCTTCTTGACCTTCAACTACAAACCCATCAGGTTGATCCATATAGATCTCCTCATCCAGCTCTCCATTAAGAAAAGC
GCTTTTCTTAATGGAGAGCTGGATGAGGAGATCTATATGGATCAACCTGATGGGTTTGTAGTTGAAGGTCAAGAAGGCAAAGTGTGCAAATTATTGAAGT[C/A]
TTTGTATGGTCTAAAACAAGCTCCTAAGCAATGTCATGAGAAATTTGACAAAACATTGACATCTGCAGGCTTTGCAGTCAATGAGGCAGATAAATGTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.50% | 21.50% | 1.02% | 38.95% | NA |
| All Indica | 2759 | 6.10% | 28.30% | 0.76% | 64.81% | NA |
| All Japonica | 1512 | 97.40% | 0.60% | 1.46% | 0.53% | NA |
| Aus | 269 | 12.30% | 78.40% | 1.49% | 7.81% | NA |
| Indica I | 595 | 3.90% | 37.60% | 0.84% | 57.65% | NA |
| Indica II | 465 | 4.30% | 6.50% | 0.22% | 89.03% | NA |
| Indica III | 913 | 3.00% | 31.00% | 0.66% | 65.39% | NA |
| Indica Intermediate | 786 | 12.50% | 31.20% | 1.15% | 55.22% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 96.00% | 1.40% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.80% | 3.32% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 57.80% | 15.60% | 1.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0717056890 | G -> DEL | N | N | silent_mutation | Average:13.913; most accessible tissue: Minghui63 flower, score: 16.541 | N | N | N | N |
| vg0717056890 | G -> T | LOC_Os07g29110.1 | downstream_gene_variant ; 3195.0bp to feature; MODIFIER | silent_mutation | Average:13.913; most accessible tissue: Minghui63 flower, score: 16.541 | N | N | N | N |
| vg0717056890 | G -> T | LOC_Os07g29110-LOC_Os07g29140 | intergenic_region ; MODIFIER | silent_mutation | Average:13.913; most accessible tissue: Minghui63 flower, score: 16.541 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0717056890 | NA | 1.38E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 1.94E-18 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 3.72E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 8.94E-23 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 1.61E-38 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 5.63E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 4.35E-07 | mr1265_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | 9.09E-06 | NA | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | 5.76E-07 | 1.34E-08 | mr1528_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 2.33E-32 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 4.16E-36 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0717056890 | NA | 3.01E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |