Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717054690:

Variant ID: vg0717054690 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17054690
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTGCTCTCCTGATCGCCGGTGCAGGCCGGCGAGTGGGATGGAGTTGTCTACGAGTGACGGCGCAGCACAGAGTAGGAGGCAAACCCTAGATTGATTTC[G/A]
CGTGTGTTGCGTGATGGCGGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCACGATCTCCACTCCGCGTAACCGAACCAGATAATT

Reverse complement sequence

AATTATCTGGTTCGGTTACGCGGAGTGGAGATCGTGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCCGCCATCACGCAACACACG[C/T]
GAAATCAATCTAGGGTTTGCCTCCTACTCTGTGCTGCGCCGTCACTCGTAGACAACTCCATCCCACTCGCCGGCCTGCACCGGCGATCAGGAGAGCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	39.40%	0.80%	0.00%	NA
All Indica	2759	92.00%	6.60%	1.38%	0.00%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	87.70%	12.30%	0.00%	0.00%	NA
Indica I	595	95.00%	3.70%	1.34%	0.00%	NA
Indica II	465	94.20%	4.70%	1.08%	0.00%	NA
Indica III	913	94.70%	3.90%	1.31%	0.00%	NA
Indica Intermediate	786	85.40%	13.00%	1.65%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	42.20%	57.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717054690	G -> A	LOC_Os07g29100.1	upstream_gene_variant ; 3334.0bp to feature; MODIFIER	silent_mutation	Average:17.991; most accessible tissue: Callus, score: 36.924	N	N	N	N
vg0717054690	G -> A	LOC_Os07g29110.1	downstream_gene_variant ; 995.0bp to feature; MODIFIER	silent_mutation	Average:17.991; most accessible tissue: Callus, score: 36.924	N	N	N	N
vg0717054690	G -> A	LOC_Os07g29110-LOC_Os07g29140	intergenic_region ; MODIFIER	silent_mutation	Average:17.991; most accessible tissue: Callus, score: 36.924	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717054690	NA	1.92E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054690	NA	8.73E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054690	NA	4.12E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054690	NA	1.29E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054690	NA	3.01E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054690	3.26E-06	8.93E-06	mr1911_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251