Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717054416:

Variant ID: vg0717054416 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17054416
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCAGATGTAAACTAGATTGAGCGCATCATTAGATCTACACATGTAAACCAGGCAGTAAAACATGAACAGATCAAATATGCGCAACATGTTGAACATGT[A/G]
CCGAGGTGGCGGAAAGACCGGTTGCTCGGCAAGAACTACTCGCAGTTGCGAGCGTCGACGAAGGCGCGAAGCACGCGAGCGGAGAGGAAGGCGAGCAGTC

Reverse complement sequence

GACTGCTCGCCTTCCTCTCCGCTCGCGTGCTTCGCGCCTTCGTCGACGCTCGCAACTGCGAGTAGTTCTTGCCGAGCAACCGGTCTTTCCGCCACCTCGG[T/C]
ACATGTTCAACATGTTGCGCATATTTGATCTGTTCATGTTTTACTGCCTGGTTTACATGTGTAGATCTAATGATGCGCTCAATCTAGTTTACATCTGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.80%	40.10%	16.91%	1.14%	NA
All Indica	2759	62.20%	7.70%	28.16%	1.88%	NA
All Japonica	1512	0.60%	99.30%	0.07%	0.00%	NA
Aus	269	82.90%	13.00%	3.72%	0.37%	NA
Indica I	595	67.70%	3.70%	27.06%	1.51%	NA
Indica II	465	54.40%	5.60%	37.20%	2.80%	NA
Indica III	913	64.80%	6.10%	27.05%	1.97%	NA
Indica Intermediate	786	59.70%	13.90%	24.94%	1.53%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	98.80%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	27.80%	58.90%	12.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717054416	A -> DEL	N	N	silent_mutation	Average:12.871; most accessible tissue: Callus, score: 21.304	N	N	N	N
vg0717054416	A -> G	LOC_Os07g29100.1	upstream_gene_variant ; 3060.0bp to feature; MODIFIER	silent_mutation	Average:12.871; most accessible tissue: Callus, score: 21.304	N	N	N	N
vg0717054416	A -> G	LOC_Os07g29110.1	downstream_gene_variant ; 721.0bp to feature; MODIFIER	silent_mutation	Average:12.871; most accessible tissue: Callus, score: 21.304	N	N	N	N
vg0717054416	A -> G	LOC_Os07g29110-LOC_Os07g29140	intergenic_region ; MODIFIER	silent_mutation	Average:12.871; most accessible tissue: Callus, score: 21.304	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717054416	NA	3.35E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054416	5.24E-08	1.35E-09	mr1265_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054416	NA	3.13E-07	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054416	NA	1.01E-18	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251