\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717054416:

Variant ID: vg0717054416 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17054416
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCAGATGTAAACTAGATTGAGCGCATCATTAGATCTACACATGTAAACCAGGCAGTAAAACATGAACAGATCAAATATGCGCAACATGTTGAACATGT[A/G]
CCGAGGTGGCGGAAAGACCGGTTGCTCGGCAAGAACTACTCGCAGTTGCGAGCGTCGACGAAGGCGCGAAGCACGCGAGCGGAGAGGAAGGCGAGCAGTC

Reverse complement sequence

GACTGCTCGCCTTCCTCTCCGCTCGCGTGCTTCGCGCCTTCGTCGACGCTCGCAACTGCGAGTAGTTCTTGCCGAGCAACCGGTCTTTCCGCCACCTCGG[T/C]
ACATGTTCAACATGTTGCGCATATTTGATCTGTTCATGTTTTACTGCCTGGTTTACATGTGTAGATCTAATGATGCGCTCAATCTAGTTTACATCTGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 40.10% 16.91% 1.14% NA
All Indica  2759 62.20% 7.70% 28.16% 1.88% NA
All Japonica  1512 0.60% 99.30% 0.07% 0.00% NA
Aus  269 82.90% 13.00% 3.72% 0.37% NA
Indica I  595 67.70% 3.70% 27.06% 1.51% NA
Indica II  465 54.40% 5.60% 37.20% 2.80% NA
Indica III  913 64.80% 6.10% 27.05% 1.97% NA
Indica Intermediate  786 59.70% 13.90% 24.94% 1.53% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 27.80% 58.90% 12.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717054416 A -> DEL N N silent_mutation Average:12.871; most accessible tissue: Callus, score: 21.304 N N N N
vg0717054416 A -> G LOC_Os07g29100.1 upstream_gene_variant ; 3060.0bp to feature; MODIFIER silent_mutation Average:12.871; most accessible tissue: Callus, score: 21.304 N N N N
vg0717054416 A -> G LOC_Os07g29110.1 downstream_gene_variant ; 721.0bp to feature; MODIFIER silent_mutation Average:12.871; most accessible tissue: Callus, score: 21.304 N N N N
vg0717054416 A -> G LOC_Os07g29110-LOC_Os07g29140 intergenic_region ; MODIFIER silent_mutation Average:12.871; most accessible tissue: Callus, score: 21.304 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717054416 NA 3.35E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054416 5.24E-08 1.35E-09 mr1265_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054416 NA 3.13E-07 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717054416 NA 1.01E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251