Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717047190:

Variant ID: vg0717047190 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17047190
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGACGGCAACGACGATGCCCCGCGGCTGAGGAGGAGAAGATGGGGTTAATCAGAGAGAAGACAGAAGAGGGGAGGCAAAGGGCGTGGGCTCACCATG[G/T]
TGAAAGGAGCCGGCGACGAAAGAGTCCCTGCGCGGCGGCGGCGTCCTGGCGGTGGCGGGGGGGGGATGACGAGGACCCGGCGGCGGCGACTCCCGATGTG

Reverse complement sequence

CACATCGGGAGTCGCCGCCGCCGGGTCCTCGTCATCCCCCCCCCGCCACCGCCAGGACGCCGCCGCCGCGCAGGGACTCTTTCGTCGCCGGCTCCTTTCA[C/A]
CATGGTGAGCCCACGCCCTTTGCCTCCCCTCTTCTGTCTTCTCTCTGATTAACCCCATCTTCTCCTCCTCAGCCGCGGGGCATCGTCGTTGCCGTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 35.80% 1.57% 0.02% NA
All Indica  2759 96.00% 3.90% 0.11% 0.00% NA
All Japonica  1512 1.70% 93.90% 4.30% 0.07% NA
Aus  269 88.50% 11.50% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 97.80% 1.70% 0.43% 0.00% NA
Indica III  913 98.20% 1.60% 0.11% 0.00% NA
Indica Intermediate  786 89.80% 10.20% 0.00% 0.00% NA
Temperate Japonica  767 1.40% 90.20% 8.21% 0.13% NA
Tropical Japonica  504 1.60% 98.20% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 46.70% 46.70% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717047190 G -> DEL N N silent_mutation Average:85.414; most accessible tissue: Zhenshan97 flag leaf, score: 94.298 N N N N
vg0717047190 G -> T LOC_Os07g29080.1 upstream_gene_variant ; 2944.0bp to feature; MODIFIER silent_mutation Average:85.414; most accessible tissue: Zhenshan97 flag leaf, score: 94.298 N N N N
vg0717047190 G -> T LOC_Os07g29090.1 upstream_gene_variant ; 2000.0bp to feature; MODIFIER silent_mutation Average:85.414; most accessible tissue: Zhenshan97 flag leaf, score: 94.298 N N N N
vg0717047190 G -> T LOC_Os07g29100.1 downstream_gene_variant ; 936.0bp to feature; MODIFIER silent_mutation Average:85.414; most accessible tissue: Zhenshan97 flag leaf, score: 94.298 N N N N
vg0717047190 G -> T LOC_Os07g29090-LOC_Os07g29100 intergenic_region ; MODIFIER silent_mutation Average:85.414; most accessible tissue: Zhenshan97 flag leaf, score: 94.298 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0717047190 G T 0.02 0.01 0.02 0.03 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717047190 NA 2.83E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.81E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.49E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 2.50E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.55E-77 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 6.73E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 3.21E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 2.55E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.72E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 2.37E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 3.34E-07 NA mr1528_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.14E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.03E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.27E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.95E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.87E-37 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717047190 NA 1.77E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251