\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717010901:

Variant ID: vg0717010901 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 17010901
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGACTGTTTTAGGGCCGTTACAGATATTTGTTGCACAGTATAAATACCCCCCACTACCTAGTGTAACTGTATCCCACTATTCACTCTTTTGGTGGGAGG[A/C]
TGTAGGGGGCGATTTTTTGTCCTTTTTCCAAGGAAAACAGAAATTAAATTCCCAAAAGTGATCAAAATGGATCAATCAAGTGAGTAATATAAATCCTTAA

Reverse complement sequence

TTAAGGATTTATATTACTCACTTGATTGATCCATTTTGATCACTTTTGGGAATTTAATTTCTGTTTTCCTTGGAAAAAGGACAAAAAATCGCCCCCTACA[T/G]
CCTCCCACCAAAAGAGTGAATAGTGGGATACAGTTACACTAGGTAGTGGGGGGTATTTATACTGTGCAACAAATATCTGTAACGGCCCTAAAACAGTCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 1.00% 3.28% 58.99% NA
All Indica  2759 4.70% 1.50% 5.44% 88.33% NA
All Japonica  1512 94.60% 0.10% 0.00% 5.36% NA
Aus  269 12.30% 0.70% 1.12% 85.87% NA
Indica I  595 3.40% 1.20% 4.37% 91.09% NA
Indica II  465 5.20% 1.50% 4.73% 88.60% NA
Indica III  913 2.20% 1.50% 5.59% 90.69% NA
Indica Intermediate  786 8.40% 1.80% 6.49% 83.33% NA
Temperate Japonica  767 93.40% 0.10% 0.00% 6.52% NA
Tropical Japonica  504 96.20% 0.00% 0.00% 3.77% NA
Japonica Intermediate  241 95.00% 0.00% 0.00% 4.98% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 57.80% 0.00% 2.22% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0717010901 A -> DEL N N silent_mutation Average:7.446; most accessible tissue: Callus, score: 16.297 N N N N
vg0717010901 A -> C LOC_Os07g28990.1 upstream_gene_variant ; 635.0bp to feature; MODIFIER silent_mutation Average:7.446; most accessible tissue: Callus, score: 16.297 N N N N
vg0717010901 A -> C LOC_Os07g29000.1 upstream_gene_variant ; 526.0bp to feature; MODIFIER silent_mutation Average:7.446; most accessible tissue: Callus, score: 16.297 N N N N
vg0717010901 A -> C LOC_Os07g28980.1 downstream_gene_variant ; 4023.0bp to feature; MODIFIER silent_mutation Average:7.446; most accessible tissue: Callus, score: 16.297 N N N N
vg0717010901 A -> C LOC_Os07g28990-LOC_Os07g29000 intergenic_region ; MODIFIER silent_mutation Average:7.446; most accessible tissue: Callus, score: 16.297 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0717010901 NA 1.82E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.00E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 2.64E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.50E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 6.14E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.28E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.95E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.05E-15 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 2.66E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.67E-85 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.39E-69 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 2.78E-22 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 2.65E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 4.32E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.43E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 4.59E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 7.75E-74 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 3.10E-06 5.04E-14 mr1630 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.05E-39 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 3.57E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 6.47E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 4.87E-79 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 4.87E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 5.72E-32 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 2.25E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 6.41E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.20E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 9.67E-43 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.82E-42 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.29E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 4.18E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 3.16E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 1.26E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 3.41E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717010901 NA 4.78E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251