Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0717006246:

Variant ID: vg0717006246 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 17006246
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, T: 0.44, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:

CATAACTCAACCACTAGAAGTAAATGTACGAGAGATCACTACGATTGACTGGTTGAGAACCAGTGAGTAGGTGTCTCTTGATCATTTGAAGTCATGGTGC[G/T]
AGGACCGCTGTGTTATTGCTGTAGTCGTACCTCGACCATCTGAGGTTGCGGTGCGAGAGATTGCTACGCACTGGTTCGAGGACCAGCGAACGTGTAGAAT

Reverse complement sequence

ATTCTACACGTTCGCTGGTCCTCGAACCAGTGCGTAGCAATCTCTCGCACCGCAACCTCAGATGGTCGAGGTACGACTACAGCAATAACACAGCGGTCCT[C/A]
GCACCATGACTTCAAATGATCAAGAGACACCTACTCACTGGTTCTCAACCAGTCAATCGTAGTGATCTCTCGTACATTTACTTCTAGTGGTTGAGTTATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.30%	24.90%	13.50%	25.22%	NA
All Indica	2759	2.90%	33.00%	22.36%	41.79%	NA
All Japonica	1512	97.00%	2.10%	0.07%	0.93%	NA
Aus	269	11.50%	82.20%	3.35%	2.97%	NA
Indica I	595	0.80%	41.70%	21.51%	35.97%	NA
Indica II	465	2.40%	10.30%	21.72%	65.59%	NA
Indica III	913	1.20%	36.50%	25.30%	37.02%	NA
Indica Intermediate	786	6.60%	35.80%	19.97%	37.66%	NA
Temperate Japonica	767	98.20%	0.10%	0.00%	1.69%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	4.10%	0.41%	0.41%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	53.30%	16.70%	11.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0717006246	G -> DEL	LOC_Os07g28980.1	N	frameshift_variant	Average:34.102; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg0717006246	G -> T	LOC_Os07g28980.1	stop_gained ; p.Glu121*; HIGH	stop_gained	Average:34.102; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0717006246	NA	2.89E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	NA	6.13E-59	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	NA	1.41E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	NA	3.26E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	2.66E-06	2.19E-71	mr1865	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	NA	1.05E-38	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	NA	5.53E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	NA	7.51E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0717006246	NA	1.87E-34	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251