\
| Variant ID: vg0716938954 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16938954 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.00, others allele: 0.00, population size: 227. )
TTCCTGTACTGATTTAACCTTTTTTTTTTACTTCGGAGTTATTTGATCAATTTAATTGAGTGATAGTTAAGTGTATATATTGTTTCTTTATTTGTGCATA[C/T]
GATACAGCACAGGTGGATACTAGTATGCCACACATGATTCATGGCTTCATGCAGCGTGATGATATCAGTTTATTTGGGGCGCCCTAAAATATGCTTCGCC
GGCGAAGCATATTTTAGGGCGCCCCAAATAAACTGATATCATCACGCTGCATGAAGCCATGAATCATGTGTGGCATACTAGTATCCACCTGTGCTGTATC[G/A]
TATGCACAAATAAAGAAACAATATATACACTTAACTATCACTCAATTAAATTGATCAAATAACTCCGAAGTAAAAAAAAAAGGTTAAATCAGTACAGGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 35.40% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 4.60% | 94.30% | 1.12% | 0.00% | NA |
| Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.20% | 92.60% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.80% | 94.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 94.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716938954 | C -> T | LOC_Os07g28890.1 | downstream_gene_variant ; 51.0bp to feature; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 81.597 | N | N | N | N |
| vg0716938954 | C -> T | LOC_Os07g28900.1 | downstream_gene_variant ; 3231.0bp to feature; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 81.597 | N | N | N | N |
| vg0716938954 | C -> T | LOC_Os07g28890-LOC_Os07g28900 | intergenic_region ; MODIFIER | silent_mutation | Average:53.181; most accessible tissue: Callus, score: 81.597 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716938954 | NA | 8.03E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 2.98E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 1.44E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 2.04E-16 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 7.48E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 3.69E-89 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | 2.00E-06 | 8.38E-73 | mr1538 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 3.36E-21 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 1.82E-19 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 4.73E-45 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | 6.46E-06 | 1.27E-63 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 1.29E-13 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 6.20E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 8.57E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 2.16E-20 | mr1689 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 1.25E-31 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 1.07E-22 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 5.11E-40 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 1.44E-42 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 8.10E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 6.22E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 2.80E-31 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 1.07E-32 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 8.86E-31 | mr1891_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716938954 | NA | 2.08E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |