\
| Variant ID: vg0716934852 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16934852 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAAATAAATAATATTTACATAATATTTTTAATAAGACGAATAGTTAAACGGTATAAAAAATTCGGTGACACGAAGGGAGTAATATATATGGTTCATCGC[C/T]
AGTGATCGAGCGATGCACGCACTGATGATCTGATCATATACGTGTTGCATTCACACGCAGGTGAAGACGAGCAGCAGCGGCGGTGGCGGGAAGGAGGGGA
TCCCCTCCTTCCCGCCACCGCCGCTGCTGCTCGTCTTCACCTGCGTGTGAATGCAACACGTATATGATCAGATCATCAGTGCGTGCATCGCTCGATCACT[G/A]
GCGATGAACCATATATATTACTCCCTTCGTGTCACCGAATTTTTTATACCGTTTAACTATTCGTCTTATTAAAAATATTATGTAAATATTATTTATTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 17.80% | 3.15% | 0.00% | NA |
| All Indica | 2759 | 97.70% | 2.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 48.40% | 42.50% | 9.06% | 0.00% | NA |
| Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 5.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 68.70% | 22.40% | 8.87% | 0.00% | NA |
| Tropical Japonica | 504 | 27.20% | 65.70% | 7.14% | 0.00% | NA |
| Japonica Intermediate | 241 | 28.20% | 58.10% | 13.69% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 89.60% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 24.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716934852 | C -> T | LOC_Os07g28880.1 | upstream_gene_variant ; 2219.0bp to feature; MODIFIER | silent_mutation | Average:59.815; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0716934852 | C -> T | LOC_Os07g28890.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.815; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716934852 | 2.44E-10 | NA | mr1238 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | 2.39E-09 | NA | mr1309 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | NA | 7.71E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | 4.20E-06 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | NA | 9.12E-09 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | NA | 6.09E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | 1.17E-07 | NA | mr1841 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | 8.59E-08 | 4.55E-15 | mr1900 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934852 | NA | 1.44E-07 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |