\
| Variant ID: vg0716934795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16934795 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACAAATATATAAAATTTAAGTTAAGTTATAGTTACATTAATAAAAGAAAATCATACCAAAATAAATAATATTTACATAATATTTTTAATAAGACGAATA[G/A]
TTAAACGGTATAAAAAATTCGGTGACACGAAGGGAGTAATATATATGGTTCATCGCCAGTGATCGAGCGATGCACGCACTGATGATCTGATCATATACGT
ACGTATATGATCAGATCATCAGTGCGTGCATCGCTCGATCACTGGCGATGAACCATATATATTACTCCCTTCGTGTCACCGAATTTTTTATACCGTTTAA[C/T]
TATTCGTCTTATTAAAAATATTATGTAAATATTATTTATTTTGGTATGATTTTCTTTTATTAATGTAACTATAACTTAACTTAAATTTTATATATTTGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 3.80% | 1.44% | 0.91% | NA |
| All Indica | 2759 | 95.90% | 0.30% | 2.39% | 1.41% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.13% | 0.07% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.40% | 0.20% | 10.75% | 5.59% | NA |
| Indica III | 913 | 99.20% | 0.00% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 96.20% | 1.00% | 1.53% | 1.27% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716934795 | G -> DEL | N | N | silent_mutation | Average:60.232; most accessible tissue: Callus, score: 81.204 | N | N | N | N |
| vg0716934795 | G -> A | LOC_Os07g28880.1 | upstream_gene_variant ; 2162.0bp to feature; MODIFIER | silent_mutation | Average:60.232; most accessible tissue: Callus, score: 81.204 | N | N | N | N |
| vg0716934795 | G -> A | LOC_Os07g28890.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.232; most accessible tissue: Callus, score: 81.204 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716934795 | NA | 2.75E-47 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | 2.02E-06 | 2.87E-56 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | 4.15E-06 | 8.27E-53 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | NA | 2.14E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | NA | 2.89E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | NA | 3.75E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | 6.74E-07 | 2.57E-46 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | 1.28E-08 | 1.46E-70 | mr1550_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716934795 | 9.02E-07 | 2.79E-40 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |