Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0716934795:

Variant ID: vg0716934795 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16934795
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACAAATATATAAAATTTAAGTTAAGTTATAGTTACATTAATAAAAGAAAATCATACCAAAATAAATAATATTTACATAATATTTTTAATAAGACGAATA[G/A]
TTAAACGGTATAAAAAATTCGGTGACACGAAGGGAGTAATATATATGGTTCATCGCCAGTGATCGAGCGATGCACGCACTGATGATCTGATCATATACGT

Reverse complement sequence

ACGTATATGATCAGATCATCAGTGCGTGCATCGCTCGATCACTGGCGATGAACCATATATATTACTCCCTTCGTGTCACCGAATTTTTTATACCGTTTAA[C/T]
TATTCGTCTTATTAAAAATATTATGTAAATATTATTTATTTTGGTATGATTTTCTTTTATTAATGTAACTATAACTTAACTTAAATTTTATATATTTGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	3.80%	1.44%	0.91%	NA
All Indica	2759	95.90%	0.30%	2.39%	1.41%	NA
All Japonica	1512	99.70%	0.10%	0.13%	0.07%	NA
Aus	269	37.20%	62.80%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	83.40%	0.20%	10.75%	5.59%	NA
Indica III	913	99.20%	0.00%	0.44%	0.33%	NA
Indica Intermediate	786	96.20%	1.00%	1.53%	1.27%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	0.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716934795	G -> DEL	N	N	silent_mutation	Average:60.232; most accessible tissue: Callus, score: 81.204	N	N	N	N
vg0716934795	G -> A	LOC_Os07g28880.1	upstream_gene_variant ; 2162.0bp to feature; MODIFIER	silent_mutation	Average:60.232; most accessible tissue: Callus, score: 81.204	N	N	N	N
vg0716934795	G -> A	LOC_Os07g28890.1	intron_variant ; MODIFIER	silent_mutation	Average:60.232; most accessible tissue: Callus, score: 81.204	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716934795	NA	2.75E-47	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	2.02E-06	2.87E-56	mr1550	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	4.15E-06	8.27E-53	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	NA	2.14E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	NA	2.89E-12	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	NA	3.75E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	6.74E-07	2.57E-46	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	1.28E-08	1.46E-70	mr1550_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716934795	9.02E-07	2.79E-40	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251