\
| Variant ID: vg0716931835 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16931835 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTTTACTTACTTTATTATCTAAAATACTTTAAACATAACTTTTTATTTTTTATATTTGCATAAATTTTTTGAATAAAATGAGTGGTCAAATATTGTAA[G/A]
AAAAACTTAAAATCCCTTATATTATGGGACGGAGGGAGTCCAGTACACTACCACTGCATTCACTCTCACACAGTACATATATACTTCCTCACTAAGCATA
TATGCTTAGTGAGGAAGTATATATGTACTGTGTGAGAGTGAATGCAGTGGTAGTGTACTGGACTCCCTCCGTCCCATAATATAAGGGATTTTAAGTTTTT[C/T]
TTACAATATTTGACCACTCATTTTATTCAAAAAATTTATGCAAATATAAAAAATAAAAAGTTATGTTTAAAGTATTTTAGATAATAAAGTAAGTAAAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.70% | 10.80% | 3.89% | 0.59% | NA |
| All Indica | 2759 | 98.10% | 0.20% | 1.01% | 0.69% | NA |
| All Japonica | 1512 | 57.10% | 32.30% | 9.92% | 0.60% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.20% | 0.65% | 0.22% | NA |
| Indica III | 913 | 98.60% | 0.30% | 0.99% | 0.11% | NA |
| Indica Intermediate | 786 | 95.70% | 0.10% | 2.04% | 2.16% | NA |
| Temperate Japonica | 767 | 71.60% | 17.60% | 9.65% | 1.17% | NA |
| Tropical Japonica | 504 | 44.00% | 48.80% | 7.14% | 0.00% | NA |
| Japonica Intermediate | 241 | 38.60% | 44.80% | 16.60% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 16.70% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716931835 | G -> DEL | N | N | silent_mutation | Average:74.846; most accessible tissue: Minghui63 root, score: 86.528 | N | N | N | N |
| vg0716931835 | G -> A | LOC_Os07g28890.1 | upstream_gene_variant ; 1928.0bp to feature; MODIFIER | silent_mutation | Average:74.846; most accessible tissue: Minghui63 root, score: 86.528 | N | N | N | N |
| vg0716931835 | G -> A | LOC_Os07g28880.1 | downstream_gene_variant ; 346.0bp to feature; MODIFIER | silent_mutation | Average:74.846; most accessible tissue: Minghui63 root, score: 86.528 | N | N | N | N |
| vg0716931835 | G -> A | LOC_Os07g28870-LOC_Os07g28880 | intergenic_region ; MODIFIER | silent_mutation | Average:74.846; most accessible tissue: Minghui63 root, score: 86.528 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716931835 | 3.98E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | 3.23E-07 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 1.92E-08 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 6.83E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | 1.04E-06 | 1.90E-12 | mr1554 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 2.23E-13 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | 3.77E-06 | 2.60E-09 | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 3.62E-12 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | 1.30E-06 | 8.06E-18 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 1.83E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | 2.25E-06 | 4.41E-10 | mr1945 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 2.27E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 9.57E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 1.58E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 5.38E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716931835 | NA | 2.26E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |