Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716931364:

Variant ID: vg0716931364 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16931364
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTAATAAGTTATTTGGATAAGCATATGAGTAAGCAAAACAATGGGGTTACTAGTATGATTAATTTTGGCCAGGCATATGTCCAGGGGCAGAGAGA[T/C]
AGGAGTAGGGCAGCTAGGGTTGCAAGCCCTACTCCTGATCCTAAATATTCATTGATTAGAAAATAAAGGAAAAAACTATATAAATTCAACTAATTGAGTC

Reverse complement sequence

GACTCAATTAGTTGAATTTATATAGTTTTTTCCTTTATTTTCTAATCAATGAATATTTAGGATCAGGAGTAGGGCTTGCAACCCTAGCTGCCCTACTCCT[A/G]
TCTCTCTGCCCCTGGACATATGCCTGGCCAAAATTAATCATACTAGTAACCCCATTGTTTTGCTTACTCATATGCTTATCCAAATAACTTATTAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	37.00%	1.38%	0.00%	NA
All Indica	2759	95.50%	3.20%	1.38%	0.00%	NA
All Japonica	1512	2.40%	95.80%	1.72%	0.00%	NA
Aus	269	74.00%	26.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.80%	0.17%	0.00%	NA
Indica II	465	97.20%	2.40%	0.43%	0.00%	NA
Indica III	913	97.70%	1.60%	0.66%	0.00%	NA
Indica Intermediate	786	89.20%	7.10%	3.69%	0.00%	NA
Temperate Japonica	767	1.30%	95.30%	3.39%	0.00%	NA
Tropical Japonica	504	3.00%	97.00%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	44.40%	54.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716931364	T -> C	LOC_Os07g28890.1	upstream_gene_variant ; 2399.0bp to feature; MODIFIER	silent_mutation	Average:58.588; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0716931364	T -> C	LOC_Os07g28880.1	downstream_gene_variant ; 817.0bp to feature; MODIFIER	silent_mutation	Average:58.588; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0716931364	T -> C	LOC_Os07g28870-LOC_Os07g28880	intergenic_region ; MODIFIER	silent_mutation	Average:58.588; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716931364	NA	5.54E-11	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.16E-26	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	1.06E-06	NA	mr1419	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	2.27E-17	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	2.17E-87	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.63E-24	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.81E-71	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.61E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	2.17E-19	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.75E-44	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	9.51E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.16E-60	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.58E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.34E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.36E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.68E-10	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	9.13E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	2.71E-80	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.63E-31	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	3.05E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.45E-54	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	7.20E-35	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	2.50E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	3.30E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.63E-41	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	1.23E-40	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	9.69E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716931364	NA	4.44E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251