\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716928375:

Variant ID: vg0716928375 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 16928375
Reference Allele: CAlternative Allele: CACTGTTACCAACGGGGACTAA,A
Primary Allele: CACTGTTACCAACGGGGACT AASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATTAAAGATCCGATCTTTACTCCCAGTTCGTAACTCCAACCGCAACTAAAGATGCTGGAGGGGCCTGACAACACCTGACAGCATGTGAACCGGGACTA[C/CACTGTTACCAACGGGGACTAA,A]
AGATCACGTAGTCTCATTCCACTTATAAACCGGGACTAAAAACCATCTTTAGTCCCGGTTTTTACTGCATCCGAGACTATTGTAGTTTTTGGTCGACCGG

Reverse complement sequence

CCGGTCGACCAAAAACTACAATAGTCTCGGATGCAGTAAAAACCGGGACTAAAGATGGTTTTTAGTCCCGGTTTATAAGTGGAATGAGACTACGTGATCT[G/TTAGTCCCCGTTGGTAACAGTG,T]
TAGTCCCGGTTCACATGCTGTCAGGTGTTGTCAGGCCCCTCCAGCATCTTTAGTTGCGGTTGGAGTTACGAACTGGGAGTAAAGATCGGATCTTTAATCC

Allele Frequencies:

Populations Population SizeFrequency of CACTGTTACCAACGGGGACT AA(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.80% 36.10% 10.16% 2.60% A: 10.35%
All Indica  2759 62.20% 3.00% 16.27% 3.37% A: 15.19%
All Japonica  1512 1.50% 95.80% 0.53% 1.98% A: 0.13%
Aus  269 62.10% 13.00% 4.09% 0.00% A: 20.82%
Indica I  595 71.10% 0.70% 17.48% 0.00% A: 10.76%
Indica II  465 54.80% 2.80% 14.84% 7.74% A: 19.78%
Indica III  913 64.80% 1.10% 14.57% 1.53% A: 17.96%
Indica Intermediate  786 56.70% 7.00% 18.19% 5.47% A: 12.60%
Temperate Japonica  767 0.40% 95.30% 0.26% 3.91% A: 0.13%
Tropical Japonica  504 2.00% 97.00% 0.99% 0.00% NA
Japonica Intermediate  241 4.10% 95.00% 0.41% 0.00% A: 0.41%
VI/Aromatic  96 2.10% 96.90% 0.00% 0.00% A: 1.04%
Intermediate  90 23.30% 51.10% 13.33% 0.00% A: 12.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716928375 C -> DEL N N silent_mutation Average:28.076; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0716928375 C -> CACTGTTACCAACGGGGACTAA LOC_Os07g28880.1 downstream_gene_variant ; 3805.0bp to feature; MODIFIER silent_mutation Average:28.076; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0716928375 C -> CACTGTTACCAACGGGGACTAA LOC_Os07g28870-LOC_Os07g28880 intergenic_region ; MODIFIER silent_mutation Average:28.076; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0716928375 C -> A LOC_Os07g28880.1 downstream_gene_variant ; 3806.0bp to feature; MODIFIER silent_mutation Average:28.076; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0716928375 C -> A LOC_Os07g28870-LOC_Os07g28880 intergenic_region ; MODIFIER silent_mutation Average:28.076; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716928375 NA 1.80E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 2.36E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.84E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 4.77E-41 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.99E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.23E-10 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.59E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 9.37E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.88E-85 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 6.31E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 5.19E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 4.39E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 8.17E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 2.04E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.56E-72 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 7.83E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.86E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.41E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 7.87E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 3.60E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 4.07E-55 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 3.03E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.83E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 4.13E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 4.65E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 8.98E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 2.55E-06 NA mr1098_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 7.57E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.51E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 2.82E-33 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 1.54E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 9.83E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928375 NA 2.77E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251