\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716928357:

Variant ID: vg0716928357 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16928357
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, G: 0.21, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGGTGTTACGAACCGGGATTAAAGATCCGATCTTTACTCCCAGTTCGTAACTCCAACCGCAACTAAAGATGCTGGAGGGGCCTGACAACACCTGACA[G/A]
CATGTGAACCGGGACTACAGATCACGTAGTCTCATTCCACTTATAAACCGGGACTAAAAACCATCTTTAGTCCCGGTTTTTACTGCATCCGAGACTATTG

Reverse complement sequence

CAATAGTCTCGGATGCAGTAAAAACCGGGACTAAAGATGGTTTTTAGTCCCGGTTTATAAGTGGAATGAGACTACGTGATCTGTAGTCCCGGTTCACATG[C/T]
TGTCAGGTGTTGTCAGGCCCCTCCAGCATCTTTAGTTGCGGTTGGAGTTACGAACTGGGAGTAAAGATCGGATCTTTAATCCCGGTTCGTAACACCAACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 36.20% 0.28% 1.31% NA
All Indica  2759 95.30% 3.10% 0.43% 1.20% NA
All Japonica  1512 2.20% 95.80% 0.00% 1.92% NA
Aus  269 87.00% 13.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 96.10% 3.20% 0.43% 0.22% NA
Indica III  913 97.80% 1.10% 0.88% 0.22% NA
Indica Intermediate  786 88.80% 7.10% 0.25% 3.82% NA
Temperate Japonica  767 0.90% 95.30% 0.00% 3.78% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716928357 G -> DEL N N silent_mutation Average:28.083; most accessible tissue: Zhenshan97 young leaf, score: 36.511 N N N N
vg0716928357 G -> A LOC_Os07g28880.1 downstream_gene_variant ; 3824.0bp to feature; MODIFIER silent_mutation Average:28.083; most accessible tissue: Zhenshan97 young leaf, score: 36.511 N N N N
vg0716928357 G -> A LOC_Os07g28870-LOC_Os07g28880 intergenic_region ; MODIFIER silent_mutation Average:28.083; most accessible tissue: Zhenshan97 young leaf, score: 36.511 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716928357 NA 1.70E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.82E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.46E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.47E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 2.33E-28 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.30E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 9.21E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 4.05E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.39E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.77E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 2.90E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.73E-20 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 5.59E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.43E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.20E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.70E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 1.92E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 1.99E-06 1.48E-07 mr1265_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 9.34E-07 4.58E-08 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 9.46E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 2.02E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716928357 NA 4.97E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251