\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716837850:

Variant ID: vg0716837850 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16837850
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTACTTTGGCTTGTTAAGAAGCTTTTATTGGGAGATAAGTTCAGATTGCTGAAGGAAACAGTCTTAACGAGCTTCTACGAATCGAGCTCGAGTCGAGCC[G/A]
AGCCTTGATCGAGCTCGAACTGAGCCTACCTTCAAGCTCGAAGGTAATGCTGGGCTCGGCTCGAGCCTGTACCGAGCTCGAGCTTAGGTAGGTAAGCTCG

Reverse complement sequence

CGAGCTTACCTACCTAAGCTCGAGCTCGGTACAGGCTCGAGCCGAGCCCAGCATTACCTTCGAGCTTGAAGGTAGGCTCAGTTCGAGCTCGATCAAGGCT[C/T]
GGCTCGACTCGAGCTCGATTCGTAGAAGCTCGTTAAGACTGTTTCCTTCAGCAATCTGAACTTATCTCCCAATAAAAGCTTCTTAACAAGCCAAAGTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.00% 3.90% 18.98% 32.14% NA
All Indica  2759 24.00% 0.80% 21.64% 53.53% NA
All Japonica  1512 87.70% 9.00% 1.98% 1.32% NA
Aus  269 2.60% 7.40% 88.85% 1.12% NA
Indica I  595 44.00% 0.00% 9.58% 46.39% NA
Indica II  465 6.00% 0.40% 14.19% 79.35% NA
Indica III  913 18.60% 0.50% 35.05% 45.78% NA
Indica Intermediate  786 25.80% 1.90% 19.59% 52.67% NA
Temperate Japonica  767 92.60% 2.90% 2.35% 2.22% NA
Tropical Japonica  504 80.20% 17.70% 1.98% 0.20% NA
Japonica Intermediate  241 88.00% 10.40% 0.83% 0.83% NA
VI/Aromatic  96 84.40% 0.00% 15.62% 0.00% NA
Intermediate  90 55.60% 5.60% 17.78% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716837850 G -> DEL N N silent_mutation Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0716837850 G -> A LOC_Os07g28760.1 downstream_gene_variant ; 411.0bp to feature; MODIFIER silent_mutation Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0716837850 G -> A LOC_Os07g28770.1 downstream_gene_variant ; 2274.0bp to feature; MODIFIER silent_mutation Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N
vg0716837850 G -> A LOC_Os07g28760-LOC_Os07g28770 intergenic_region ; MODIFIER silent_mutation Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716837850 NA 1.97E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 1.44E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 2.14E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 1.86E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 1.58E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 5.90E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 1.75E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 1.80E-06 NA mr1916_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 2.48E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850 NA 5.21E-11 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251