Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716837850:

Variant ID: vg0716837850 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16837850
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTACTTTGGCTTGTTAAGAAGCTTTTATTGGGAGATAAGTTCAGATTGCTGAAGGAAACAGTCTTAACGAGCTTCTACGAATCGAGCTCGAGTCGAGCC[G/A]
AGCCTTGATCGAGCTCGAACTGAGCCTACCTTCAAGCTCGAAGGTAATGCTGGGCTCGGCTCGAGCCTGTACCGAGCTCGAGCTTAGGTAGGTAAGCTCG

Reverse complement sequence

CGAGCTTACCTACCTAAGCTCGAGCTCGGTACAGGCTCGAGCCGAGCCCAGCATTACCTTCGAGCTTGAAGGTAGGCTCAGTTCGAGCTCGATCAAGGCT[C/T]
GGCTCGACTCGAGCTCGATTCGTAGAAGCTCGTTAAGACTGTTTCCTTCAGCAATCTGAACTTATCTCCCAATAAAAGCTTCTTAACAAGCCAAAGTAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.00%	3.90%	18.98%	32.14%	NA
All Indica	2759	24.00%	0.80%	21.64%	53.53%	NA
All Japonica	1512	87.70%	9.00%	1.98%	1.32%	NA
Aus	269	2.60%	7.40%	88.85%	1.12%	NA
Indica I	595	44.00%	0.00%	9.58%	46.39%	NA
Indica II	465	6.00%	0.40%	14.19%	79.35%	NA
Indica III	913	18.60%	0.50%	35.05%	45.78%	NA
Indica Intermediate	786	25.80%	1.90%	19.59%	52.67%	NA
Temperate Japonica	767	92.60%	2.90%	2.35%	2.22%	NA
Tropical Japonica	504	80.20%	17.70%	1.98%	0.20%	NA
Japonica Intermediate	241	88.00%	10.40%	0.83%	0.83%	NA
VI/Aromatic	96	84.40%	0.00%	15.62%	0.00%	NA
Intermediate	90	55.60%	5.60%	17.78%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716837850	G -> DEL	N	N	silent_mutation	Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0716837850	G -> A	LOC_Os07g28760.1	downstream_gene_variant ; 411.0bp to feature; MODIFIER	silent_mutation	Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0716837850	G -> A	LOC_Os07g28770.1	downstream_gene_variant ; 2274.0bp to feature; MODIFIER	silent_mutation	Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N
vg0716837850	G -> A	LOC_Os07g28760-LOC_Os07g28770	intergenic_region ; MODIFIER	silent_mutation	Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716837850	NA	1.97E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	1.44E-06	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	2.14E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	1.86E-06	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	1.58E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	5.90E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	1.75E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	1.80E-06	NA	mr1916_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	2.48E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716837850	NA	5.21E-11	mr1942_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251