\
| Variant ID: vg0716837850 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16837850 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTACTTTGGCTTGTTAAGAAGCTTTTATTGGGAGATAAGTTCAGATTGCTGAAGGAAACAGTCTTAACGAGCTTCTACGAATCGAGCTCGAGTCGAGCC[G/A]
AGCCTTGATCGAGCTCGAACTGAGCCTACCTTCAAGCTCGAAGGTAATGCTGGGCTCGGCTCGAGCCTGTACCGAGCTCGAGCTTAGGTAGGTAAGCTCG
CGAGCTTACCTACCTAAGCTCGAGCTCGGTACAGGCTCGAGCCGAGCCCAGCATTACCTTCGAGCTTGAAGGTAGGCTCAGTTCGAGCTCGATCAAGGCT[C/T]
GGCTCGACTCGAGCTCGATTCGTAGAAGCTCGTTAAGACTGTTTCCTTCAGCAATCTGAACTTATCTCCCAATAAAAGCTTCTTAACAAGCCAAAGTAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.00% | 3.90% | 18.98% | 32.14% | NA |
| All Indica | 2759 | 24.00% | 0.80% | 21.64% | 53.53% | NA |
| All Japonica | 1512 | 87.70% | 9.00% | 1.98% | 1.32% | NA |
| Aus | 269 | 2.60% | 7.40% | 88.85% | 1.12% | NA |
| Indica I | 595 | 44.00% | 0.00% | 9.58% | 46.39% | NA |
| Indica II | 465 | 6.00% | 0.40% | 14.19% | 79.35% | NA |
| Indica III | 913 | 18.60% | 0.50% | 35.05% | 45.78% | NA |
| Indica Intermediate | 786 | 25.80% | 1.90% | 19.59% | 52.67% | NA |
| Temperate Japonica | 767 | 92.60% | 2.90% | 2.35% | 2.22% | NA |
| Tropical Japonica | 504 | 80.20% | 17.70% | 1.98% | 0.20% | NA |
| Japonica Intermediate | 241 | 88.00% | 10.40% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 15.62% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 5.60% | 17.78% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716837850 | G -> DEL | N | N | silent_mutation | Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0716837850 | G -> A | LOC_Os07g28760.1 | downstream_gene_variant ; 411.0bp to feature; MODIFIER | silent_mutation | Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0716837850 | G -> A | LOC_Os07g28770.1 | downstream_gene_variant ; 2274.0bp to feature; MODIFIER | silent_mutation | Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| vg0716837850 | G -> A | LOC_Os07g28760-LOC_Os07g28770 | intergenic_region ; MODIFIER | silent_mutation | Average:31.363; most accessible tissue: Minghui63 young leaf, score: 56.213 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716837850 | NA | 1.97E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 1.44E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 2.14E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 1.86E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 1.58E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 5.90E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 1.75E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | 1.80E-06 | NA | mr1916_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 2.48E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716837850 | NA | 5.21E-11 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |