Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716827828:

Variant ID: vg0716827828 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16827828
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTCCGGAAAGCAGCGGTGAATTCAAGCCAAGAGATAGGTTCAGCAGTAGTCCTGTTAAGGCGGAAGTGATCCCACCACTCCGATGCAGGGCCATGCAG[C/T]
TGGTGTGAAGCAAAAGAGACCTTCTCCTGGTCTGTGCACTGAAGCAGATCCAACTTCTTCTCTATGGCGTGCAGCCAATCGCCAGCTTCAACAGGATTAG

Reverse complement sequence

CTAATCCTGTTGAAGCTGGCGATTGGCTGCACGCCATAGAGAAGAAGTTGGATCTGCTTCAGTGCACAGACCAGGAGAAGGTCTCTTTTGCTTCACACCA[G/A]
CTGCATGGCCCTGCATCGGAGTGGTGGGATCACTTCCGCCTTAACAGGACTACTGCTGAACCTATCTCTTGGCTTGAATTCACCGCTGCTTTCCGGAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 8.80% 5.18% 5.42% NA
All Indica  2759 67.90% 14.90% 8.59% 8.70% NA
All Japonica  1512 99.00% 0.10% 0.20% 0.73% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 88.40% 1.20% 6.55% 3.87% NA
Indica II  465 58.90% 14.40% 9.03% 17.63% NA
Indica III  913 56.30% 27.70% 9.42% 6.57% NA
Indica Intermediate  786 71.00% 10.60% 8.91% 9.54% NA
Temperate Japonica  767 98.40% 0.00% 0.26% 1.30% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 6.70% 4.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716827828 C -> DEL LOC_Os07g28750.1 N frameshift_variant Average:50.339; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N
vg0716827828 C -> T LOC_Os07g28750.1 synonymous_variant ; p.Gln278Gln; LOW synonymous_codon Average:50.339; most accessible tissue: Zhenshan97 flag leaf, score: 91.854 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0716827828 C T 0.01 0.0 0.0 0.03 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716827828 NA 4.86E-09 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 5.17E-08 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 4.46E-08 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 6.62E-07 1.17E-15 mr1118 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 6.76E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 5.59E-06 6.31E-08 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 4.87E-07 2.16E-10 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 1.68E-14 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 3.51E-07 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 5.40E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 4.92E-09 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 6.46E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 9.85E-06 3.89E-16 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 1.87E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 1.49E-09 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 1.52E-09 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 5.04E-06 9.08E-08 mr1258_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 2.09E-06 1.13E-16 mr1495_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716827828 NA 4.51E-06 mr1866_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251