\
| Variant ID: vg0716785759 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16785759 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCGGCATGTGGAGACATAAGCGCCACATTGCCATTATGTTGATGACATGATTTGTGAAAGGAGAAATAAAATTAAACAATGGTTTTCGACTGGGGCGGAC[A/G]
GAGGATTTGGGTGGTATCTGGGAAAGGCTAGTACCGTCCCCGGTCAATTAAGGACTGAGCCATGAAGTTAAGCATGAAACGACCCCCGTACAACCGTACT
AGTACGGTTGTACGGGGGTCGTTTCATGCTTAACTTCATGGCTCAGTCCTTAATTGACCGGGGACGGTACTAGCCTTTCCCAGATACCACCCAAATCCTC[T/C]
GTCCGCCCCAGTCGAAAACCATTGTTTAATTTTATTTCTCCTTTCACAAATCATGTCATCAACATAATGGCAATGTGGCGCTTATGTCTCCACATGCCGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.40% | 5.00% | 24.88% | 22.73% | NA |
| All Indica | 2759 | 28.00% | 0.80% | 35.48% | 35.74% | NA |
| All Japonica | 1512 | 83.50% | 13.30% | 1.79% | 1.39% | NA |
| Aus | 269 | 21.60% | 3.70% | 55.39% | 19.33% | NA |
| Indica I | 595 | 44.50% | 0.00% | 17.14% | 38.32% | NA |
| Indica II | 465 | 6.90% | 0.90% | 46.45% | 45.81% | NA |
| Indica III | 913 | 25.70% | 0.50% | 44.03% | 29.68% | NA |
| Indica Intermediate | 786 | 30.50% | 1.70% | 32.95% | 34.86% | NA |
| Temperate Japonica | 767 | 86.80% | 9.40% | 1.43% | 2.35% | NA |
| Tropical Japonica | 504 | 79.80% | 18.10% | 1.98% | 0.20% | NA |
| Japonica Intermediate | 241 | 80.90% | 15.80% | 2.49% | 0.83% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 5.60% | 20.00% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716785759 | A -> DEL | N | N | silent_mutation | Average:32.011; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0716785759 | A -> G | LOC_Os07g28670.1 | downstream_gene_variant ; 2486.0bp to feature; MODIFIER | silent_mutation | Average:32.011; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0716785759 | A -> G | LOC_Os07g28660-LOC_Os07g28670 | intergenic_region ; MODIFIER | silent_mutation | Average:32.011; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716785759 | NA | 4.98E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0716785759 | 3.46E-06 | NA | mr1128_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716785759 | 7.03E-06 | NA | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716785759 | 3.10E-07 | 3.10E-07 | mr1806_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |