\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716748284:

Variant ID: vg0716748284 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16748284
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCAAGACAATTTTTTGGTCGTTTGACTCATGCCCTCTAGTGTGATGTAGTGACTACGACTAGGAGGTAGGAGAAGAGTAAAGGTTATTGTTGAGAGTAA[A/T]
GCACCAATCTAAAAGCAATATAATGGTATGAAAATTTTTTCTGAGATATACGTTTCCAATTGAATTACTTATCAGTAAGACCCATATAACTAGTTGTAAG

Reverse complement sequence

CTTACAACTAGTTATATGGGTCTTACTGATAAGTAATTCAATTGGAAACGTATATCTCAGAAAAAATTTTCATACCATTATATTGCTTTTAGATTGGTGC[T/A]
TTACTCTCAACAATAACCTTTACTCTTCTCCTACCTCCTAGTCGTAGTCACTACATCACACTAGAGGGCATGAGTCAAACGACCAAAAAATTGTCTTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 17.50% 0.42% 0.00% NA
All Indica  2759 70.60% 28.70% 0.65% 0.00% NA
All Japonica  1512 98.70% 1.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 34.40% 63.70% 1.94% 0.00% NA
Indica III  913 63.20% 36.10% 0.66% 0.00% NA
Indica Intermediate  786 78.80% 20.90% 0.38% 0.00% NA
Temperate Japonica  767 97.70% 2.20% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716748284 A -> T LOC_Os07g28614.1 upstream_gene_variant ; 656.0bp to feature; MODIFIER silent_mutation Average:87.675; most accessible tissue: Minghui63 flag leaf, score: 95.269 N N N N
vg0716748284 A -> T LOC_Os07g28610.1 downstream_gene_variant ; 2774.0bp to feature; MODIFIER silent_mutation Average:87.675; most accessible tissue: Minghui63 flag leaf, score: 95.269 N N N N
vg0716748284 A -> T LOC_Os07g28620.1 downstream_gene_variant ; 2666.0bp to feature; MODIFIER silent_mutation Average:87.675; most accessible tissue: Minghui63 flag leaf, score: 95.269 N N N N
vg0716748284 A -> T LOC_Os07g28610.3 downstream_gene_variant ; 2776.0bp to feature; MODIFIER silent_mutation Average:87.675; most accessible tissue: Minghui63 flag leaf, score: 95.269 N N N N
vg0716748284 A -> T LOC_Os07g28610.2 downstream_gene_variant ; 2774.0bp to feature; MODIFIER silent_mutation Average:87.675; most accessible tissue: Minghui63 flag leaf, score: 95.269 N N N N
vg0716748284 A -> T LOC_Os07g28610-LOC_Os07g28614 intergenic_region ; MODIFIER silent_mutation Average:87.675; most accessible tissue: Minghui63 flag leaf, score: 95.269 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0716748284 A T -0.02 -0.02 -0.02 -0.03 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716748284 NA 4.34E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716748284 NA 8.59E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716748284 NA 1.01E-09 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716748284 3.41E-06 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716748284 3.98E-06 NA mr1686 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716748284 1.85E-06 NA mr1686 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716748284 1.41E-06 NA mr1754 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716748284 3.96E-06 2.73E-06 mr1754 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251