Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716717405:

Variant ID: vg0716717405 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16717405
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTATGATGGCTTGCGTTCTCGGGATTAGTGCTTCCATCATTATGATACTCTAATCTTGTCTATGTAATTCGTCGAGTTATCATATATCTTATATAATCT[C/G]
TGGCAATATCGTTATCTAACCTACAATCGGCTAATATCTATCAATAGAGGGCTGCCGATTAGGTTAAATATTGATGTTGATTTAGATTATATACGATATC

Reverse complement sequence

GATATCGTATATAATCTAAATCAACATCAATATTTAACCTAATCGGCAGCCCTCTATTGATAGATATTAGCCGATTGTAGGTTAGATAACGATATTGCCA[G/C]
AGATTATATAAGATATATGATAACTCGACGAATTACATAGACAAGATTAGAGTATCATAATGATGGAAGCACTAATCCCGAGAACGCAAGCCATCATAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.90%	8.00%	14.16%	37.98%	NA
All Indica	2759	25.20%	0.50%	17.62%	56.76%	NA
All Japonica	1512	69.60%	22.80%	6.08%	1.46%	NA
Aus	269	10.80%	0.00%	24.91%	64.31%	NA
Indica I	595	39.80%	0.20%	18.49%	41.51%	NA
Indica II	465	10.80%	0.40%	16.77%	72.04%	NA
Indica III	913	20.70%	0.40%	16.65%	62.21%	NA
Indica Intermediate	786	27.70%	0.80%	18.58%	52.93%	NA
Temperate Japonica	767	88.30%	2.70%	6.65%	2.35%	NA
Tropical Japonica	504	47.40%	48.40%	3.97%	0.20%	NA
Japonica Intermediate	241	56.80%	33.20%	8.71%	1.24%	NA
VI/Aromatic	96	78.10%	3.10%	9.38%	9.38%	NA
Intermediate	90	36.70%	18.90%	16.67%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716717405	C -> DEL	N	N	silent_mutation	Average:16.813; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg0716717405	C -> G	LOC_Os07g28560.1	upstream_gene_variant ; 873.0bp to feature; MODIFIER	silent_mutation	Average:16.813; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N
vg0716717405	C -> G	LOC_Os07g28560-LOC_Os07g28570	intergenic_region ; MODIFIER	silent_mutation	Average:16.813; most accessible tissue: Zhenshan97 flag leaf, score: 39.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716717405	NA	5.73E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	4.64E-06	4.63E-06	mr1286_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	3.42E-06	3.42E-06	mr1286_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	4.02E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	4.15E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	6.33E-06	mr1397_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	5.19E-06	5.19E-06	mr1412_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	9.41E-06	mr1417_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	2.97E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	7.51E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.12E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	5.81E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	2.82E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	7.63E-09	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	7.52E-08	mr1556_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	3.33E-07	mr1594_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.59E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.01E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	3.49E-06	8.96E-08	mr1665_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	4.33E-07	mr1665_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.72E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.08E-07	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	5.28E-06	5.28E-06	mr1687_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	8.77E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	8.82E-06	8.82E-06	mr1700_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	7.00E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.63E-07	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	4.09E-06	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	9.41E-06	mr1759_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.62E-08	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.75E-07	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.48E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	5.52E-06	5.52E-06	mr1811_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	4.28E-07	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	2.54E-06	mr1812_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	7.52E-06	7.51E-06	mr1814_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	9.39E-06	mr1816_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	7.42E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	6.30E-06	6.30E-06	mr1840_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.10E-09	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	2.11E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716717405	NA	1.38E-06	mr1976_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251